Transcript Name :
Phyca_LT1534551109
Orientation:
(+)
Number of Exons:
1
Description :
PREDICTED: protein AATF-like
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-433
NN-scoreoddsWeighted Score
0.7664.0320.008
*** None ***
TypeScore
nuclear913
GO
*** None ***
*** None ***
Cluster Id
3748
Sequence
        1299 bases(100 bases per row)
atggcacgcgacgagttcaacatcgacgaggcggaagactttgacgacggtacacgcgctgttctgcatgatgacgcgtcggattcagccgaagaaactc
aggactcgacgcgtctgcgctcgtcccgcaagcagcgactacaggcagagcgcaaaggcggaaaacaacgcgaacaagcgtctgctctgcgtgttaagaa
ctgggacgctgggctgatggagtctgaagaatatgctggcaaagtggtgaagcggaaggatttaagtgacggaatggagtcgcctgacgaggacgcgatg
gctcagtggtcggatgcggaaccctttggagcttcggatgaagaagaagaggaggagaagattgaagaagaagaagatagtgaggaggaaagtgatgaag
aggacaagagtgcggagatgctcatcagaggcttccagaaggaggactcggcgagactcatgggtgctcaagacagcgagaaggttgtggagaaggctaa
acacgtgcgaaaccaaaagctcgtttgggaacgctgtcttgaagtgcagatctacactaagagactgttgacgaccgtcaaggattcagcaaatgagacg
gatggagagacaactgacgaagatacagcctcaaagacaaaggagaaggtgctggctgagctctacaacagtattgatgctgtctcagcgctacaggtga
agctgtgcaacgtcccagagctaaatgctcttgatagcccgacgaagaagcgtaagcgaacgtgcgacgagctgtggcaggagattacaaccagcaaccg
tgctatgctccctcagtataacgaaatcctcaacacatacacgcgcaagacggatctggcagcaggaggcaaaaacaaccaagccaagaagttcaaagct
gtgaaccaagacatcctcgcgcaggtcgagtcggtcctggttgacccccagcgagtgaaacgaaaggcacacgctccattagacgtgccagaggctgagg
caacagagggacttgaagatctgctggatgagctcatgtacgacgactcggacttctaccagcagcttctgaaggagtttattgagagtggaggaggtgg
tgctggtcaggaagcaatggtgcgacgcactcaccgcaagaagaagaaactcgtcaaccgcaaagccagtaagggccgtcaattgcggtacaccgtgcac
cccaagctggagaactttatgttcccggagccttacccacagccggagatggacgtgacggagctcttccgctcactctttggccaagtccggcagtag