Transcript Name :
Phyca_LT153435736
Orientation:
(+)
Number of Exons:
2
Description :
myotubularin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myotubularin phosphatase domain82.257PS51339
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-355
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
phosphatase activityGO:0016791IEA
*** None ***
Cluster Id
811
Sequence
        1107 bases(100 bases per row)
aatgatcggggaaacatttgcaagtcgtacccatcaaagttactcctcccagcgtctatgaattcctcgacgctggctaaagtggctgacttccgcgcga
agaaccgactgcccgtgatcacgtattaccaccgtcgtaatcggtgtgtactgactcgctccagtcagcctcttctaggcagtttgctctcgggcagctc
caacgtctccgatcaactgctgttgggtgtgtatcgccgattaccggatattatcaagaaccagtcgcagtcgtcgcaatcttcccgacctatctatata
tttgatgctcggaagccaaaggcatccacaggtaatcgattaatgggcaagggtggcgtcgagactccgcaggattatccaggagccgttatccaccacc
tgaatatcgccaacatgtaccgtatgcagtcttcattcatgggattgatgaaactgtttttacctggaggtattgacgattctgaccgaacgtggctatc
cagtgtggaatcgacgagatggctggatcatgtgcgcctggtactggatggtgcgctgaaaattgcgcgcgtattggagctagaaggagcttctgctctt
gtgcattgcagtgatggctgggaccgaacagctcaactgtgtgctctagcgcaactgatgatcgatccgtacttccgtaccatacgtggatttgctactc
tagtggaaaaagattggctagcgtttggtcacaaatacgcggagcggacttcaggggaccgtaaccgagacccgcagcgaaacaaagcctcaccgatcat
gttccagtttatcgatgccgtgtggcagatgcaacgtcaatatccacgatcgttcgagttcaacgaacgctttttactgcatttggcgaattcgatgacc
tcggggctttatggaacattcctgtacgactcacggctccaacgagatgtgaatgaggtgaagtacaactcagtctcggtgtggacaccggtcctgttgc
ggccagagctgtactcaaacagtgactacgagatgtataatggtcccatttggccctgggtgagctgcaaaatgcttcgcttgtgggagaactacttttt
ccagtgg