Transcript Name :
Phyca_LT153434841
Orientation:
(+)
Number of Exons:
2
Description :
tRNA (cytosine5)methyltransferase NSUN2 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
tRNA (C5-cytosine) methyltransferase, NCL13.01PR02011
RNA (C5-cytosine) methyltransferase1.15PR02008
RNA (C5-cytosine) methyltransferase1.15PR02008
RNA (C5-cytosine) methyltransferase1.15PR02008
RNA (C5-cytosine) methyltransferase1.15PR02008
tRNA (C5-cytosine) methyltransferase, NCL13.01PR02011
RNA (C5-cytosine) methyltransferase1.15PR02008
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA (C5-cytosine) methyltransferaseIPR023267
*** None ***
InsideOutsideTMhelix
1-390
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2475
Sequence
        1239 bases(100 bases per row)
aacgagaactttgacgcatactacaaggcgcagaacatcatggaagagtcggactgggtcgcgttcaagaaggcattggccacgccactgcctacgacgt
tccgtatcaacagctcgtgtccatttgctgaccggtaagttgtctatggtattgcacaacttttaggagctttacagctcattgtttttgtgtgttggta
tagcattcgtgaccacattgaacaggattttaagttcgacggcctagtggtggacgacgagcctgtggaacccattagccccatgccctggtaccctgac
aaccgtggcttcacgtggtcagtggaacgccgtcgtgtgcgtaagctaccgattctgaaggagttccagtcttggctcgtagagctctcgaacagtggaa
gcatcactcgccaggaggctgtgagcatgatcccgccccttgtgctgggtgtggagccgcatcataaggtgttggacatgtgcgctgctcctggctccaa
gacgtcgcagcttctcgagtccctccactcgcaggagtttgcaacaggcaagaccccaactggtgtggtagtggccaacgacgtggaccttaagcgcgcg
tacatgctggtgcaccagtccaagcgtatcagttcacctgctttgctcgtgacttgtcacgaagcacagaacatcccgttcctcggcaaggacggaacgg
aaagcgaaggagtttttgaccgcattctgtgtgacgctccctgcagtggcgacggaactttgcgtaagaacccattgatctggaagacatggagtgccaa
gaacggtattgcacttcacccgttgcagctgcagattgctaagcgcggtgcggcgctgctgaaggttggcggcaatatgtgctactcaacgtgcacgttc
aaccctctggagaatgaagcggtggtggctgacttgctgcgctggggcaagggctcgctggagcttgtggatgtgtcgaacaccctgccactgctgaagc
gccgtcctggtatcagcacttggaaggtgttgaactcgcagctgaaggagtacacgtcctacgacaattatgttgaggagaacatgaaggacaagaccaa
ggataaaattcgtgccacaatgttcccgccgactgagaaggaagctgcggatctccatcttgagcgctgcatgcgctgtctgcctcaagacgagaacact
ggtggatttttcatatgcttgttgaagaaggtggcaccc