Transcript Name :
Phyca_LT1534115114
Orientation:
(+)
Number of Exons:
1
Description :
helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-303
NN-scoreoddsWeighted Score
0.8194.3020.009
*** None ***
TypeScore
mitochondrial913
GO
*** None ***
*** None ***
*** None ***
Sequence
        909 bases(100 bases per row)
atgcctttgacaagtcgtcgctcctggctggaaagcgtccacacacagctccgacgccagagcacgcgctcctcagcgcatcaacagcgtcagttcgaat
tgctggtgcctgcgttgcagactttccagcgcctccgcggccattttgccgttccgttgcgcttcatcatcccaagcagccagagttcagagggtgagca
atggcccaacgagctgcaggggatgaagctaggtacaaccatctcgcgatttctgaaggcttccgcaatggccaagaaacccggaagaaaacgaagtttg
gacgaaattcgagaaaaactgcaggagcttgggctgccagacgttgtagattggaagcggttcctgtgggaagaggtatctgtaccagcgatgcggacat
acaactcaatccacggggatctcttcgtgccggtgtcgtttacggtacctgttggagatgttatgtggccatgctcgacgtgggggtacaagttgggcta
ctggacaagtgagcttcgtcgtcgcaaagataacctgccacagtatcaacttgaggatctgaacgagctgggcttcaactggagtgttcaagaaggtcgt
tggaatcgctatttccttcctgcgctgcagaaatatcacgagttgtatggcgatcggcacgtaccccagcgtttcgtagttcccagcgacgacccggact
ggccggcagagttaagtgggtatcgccttgggcagaaagtgaacaatttgcgctgtggaaacccgatgaacaatgtggacgagttgcaagatatcgactt
gctgttcaagaattggatgctccttgagacccttcacgaagttagtgaaaatggcgaagtaggcgccacacacttagaccaaaacgacgaagaggcaatg
caccagtag