Transcript Name :
Phyca_LT1534566653
Orientation:
(+)
Number of Exons:
1
Description :
Amino Acid/Auxin Permease (AAAP) Family
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3650.55128
InsideOutsideTMhelix
38-65
111-116
177-191
268-351
404-415
1-14
89-92
140-153
215-244
375-383
436-470
15-37
66-88
93-110
117-139
154-176
192-214
245-267
352-374
384-403
416-435
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1496 bases(100 bases per row)
gcggccttcttcacgctcgaggacgccaagatcagcttcagcatcatctgctgcatctgcggcatcgggacactcgccatgccgtccaatttcgcccgtg
ctggacccgtgtacggcactatcgcgatgctcttcatggcgttcgccaacatttacgcgacggtggccttgtcacgcgtcatcctcgtggcgccgccgtc
cgtcaagacgttcggtgatgtcggcggctgggtgctcggtgctcccggtcgctacgccgtcatgatctcgcagttgctcgtgtgtctgctactaccctgc
gccttcctggttctaggtagtacactacttgacgtgctgttcccggacgccttcagtcagatcttctggatcattttcatggccatcacagccgtgccgg
cgtgtctgatcccgaccctcaaggccgccgcgaccgtcgccttcatcgggtgtatgggcacgatcatcgccgacgtggtgggcgtcagcgtcttggaatg
ggaaatgcgtggccacccggccgcgccgtcgccggatatctcgttgcaccaggtgctcacggcgttcggcaacttgtcgctagcgtacggcgtcgccgtg
ctgatcccggacttacagcggcagcactcgcagccgaaacggatgccgcgcgtcatcgtggtgagtctcggcatcggttcggcctttttcctggccgtgg
ctattgccggctacgtggctggtggctgccagctttcggctaatctgctcttctcgatcgtcaacattgcagacccgtcggcgccgtcggcgttggggtt
cgtgcccgaccacggcgcggtcatcatggcgtatctgttcatgcatctgcacgtcgtcattgttctgtcgacggtgcttcagccgccgttctacatggcc
gaacgtctcatcctgggcatgcacaaggacgccgtggccatccaggccgaggacaacgacggatgggaggagattcgcgacaagatgtcgacgaacgacc
cgagcgtcaacgcacgtgacctggagaacaacgccgactcggacacggagacgctgtcgaactcggccaagcgcgagcaggaggagaaggagcacgacga
cgcgcaactctcggactacagcggctcggccaacgtgttccgctacgtgacgttgcgtctggtcattatggccatcctggtcggcgccgccatcggcttc
cgcgaccatttcctggacctggtggactttacgggcgcgtcggccatcaccgtgtgctgcctggttctacctctcatcttctacctgaaggtgttctggc
gcgacttgcccatgtacgagcgtgtggtggcggccgtggtcatcgtggtctgcaccgtcgtgggctgctacgtgatgatctacgccggcaagaacctttt
cagcccggactcggacagcgccacgttcccgtactgctcggaggagttccagtcggagccgtactacgtgcgtaacccgacggcgtgaatggcggg