Transcript Name :
Phyca_LT1534557865
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
WD40 repeat430SM00320
WD40 repeat0.38SM00320
WD40 repeat20SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-998
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
2031
Sequence
        3065 bases(100 bases per row)
atggagaccatgagggagatcgccgtgaatgccaacggcaaaggcgctatggagctggtgacgacgctgcgtcccatgaaggacggacaggttcctgcag
gtcgtgacgtcgtcttcaccagtggagaggatggcgtcctgtacgtgacggacttgacgactgagagctccgtgtaccaagccgaagtgtgcgatggctt
cgttccttccttcgctgtgacgccgaagcagaaccacgtgctgatagtgtcagaggacgacagcgacgtggcgtcctacagtctcccgcccgattgcaaa
agggaccagctcctacgtcgctctacagttcctattcgtcaggtcacgtgctcctctaagttcatcgcgattgcagatgaagagcctgtggtacgggtgt
tgctgcgtagtaatattgaacaggttattcttgctgagggggccactggaattatcaagagcgtggtgttagatccgcaggagaagtatctgtgcaccag
cagtgaggacgcgactgtgcgggtctttgcgttggatccagaaggccaacgagctacggaggccaaaagctttaagatcaagcatggagacatcaagaac
gacgatgttctgctgagatgtgcttggcagcctagtgacaagggtaaattgctggctgtgcccatggacaaggggattattgagctttttgagagagata
cgtggacttcaaagggaagaataatgttacctcttggcaaaagcactgctgctgatgtggatatcctggccttctcgccgaacggacagtatttggctgc
agtgacagttgccaaggaagtgtttgtgtgggagttggagacgcagacgattctgcgctcgtttcggattgattacccagcgctgggcgtgcagtttgcc
aacaagagcaatgcgatggtgctctatcacactggaggcaagttggccttcgttaaagatgtgattccggctgggcacacgccgcctcaacatgtgatcg
gacagccagttgttgcagttaattcttcgcaatcaagaaagaaaaatttaaaagcttcttcatttgtggaagaagaagctgaagtggatggaaatggtga
cgatgaagaggaagtgagttttgatgatgacaacgacgctcgagtagaggctatcaaagccagttttggctttggtacagctgcagataccaaggaagaa
gaagaccctgtatttcctgtacaaactacgaagacctcccaccaagaagtgtccgccctccgtacaattactgagcccttccagcccggtagtgtcatgg
actctactggacgcagcagtagtgccacgtcactattggcatggactcctgagggtgagatcgaggtgatccgtggcgctacaatgagtgagaacttggt
gaaggtggagttcaccgacaagtctcgtcgtggcttcaagttcaacgacaactacatgttctcgatggccttcctcgacgactacggtgccatcttcgct
gtcccacgacgcgcgcgtgaagattgggaggaccacgaagctggctccactgaaagtgacgtgatcagcagctttgtgttctaccgtccgtttgagtcct
gggccagcaacagttcgtggcacaagacgttgccggagggtgaagacgccgagtgcgtcaccgcaggtcgcgagttctgtgcagtggctacctcattgca
atcgctacggatttacacaaccagtggcattgactacgcgctgctacgtcttcccgggcgtgtcgtgacgatgacagccaaggaatctcttcttgctgtg
gtgtatcagggccttcacggccagatgcattaccagctcctccgcatccaagttggttcgtcccgggagcgagtgatgctactctcaaagggtgaactgc
ccatgacgccacctccaagagatgtgtttgcgtcacacaaggagaacgaagcaattcgtcaagatatatcgaactggtcgaagctcacttggctcggttt
cgacgaccgccagattctctacgctgtggactccttctcttgcatccaggcgctgtcccctagcattggatggaactggttccccgtcggatgcgtgggt
aacgcgttgcagaagaagcctgaggaccggcacggtgtctttacgcttggtgttgtcaacgattcgctgctctacttcccgcttgaaagtggcgctcgtg
ccccgaagctccgcggaaaccaccgtcctgtgcctggtacgttcccactgcgcacagcatctttcccaaggacgtcaaagaagaacgaggccgcctcgaa
cggtgccatgtggcagaatgtgcggctctgtggactcgaagccgtcgcgaatgagttgaaagccgatgaagttgcggatcaagtcgtgcaggaacaggcc
gagatggacaagtcgctcattctgatgatgaagacggcctgcaccaacgatgaacctgcacgggtcctcgacttggcaaagtgtttgcaccttgagaagt
cccaccaaatcgcacagaagctcgcgattcatttctcattgcgccaattgcagtctcagctgtatgagctctaccgcattaaattcgaggagcccaagcg
cttggagcaggaagcacttcaagcgtcttcccagtcgtaccgaccatcgcgatcgtacgttcaagaggaagaaccccccgaacagcgcgaaatggagccg
cttcgtcgtgcccgtagcattttatctcgacctccagcttcaccacctcgtgacgaacagcaaaatgacgacactgcatctgtggatgaaacacaagagg
aaaaggctgttagtgctacgaagagcagcgcgcctcgtgtggagcggtcagtggcaccagcaaatccgttcctgaagaaacctggaggctcgacagcgtc
accttctggcaaaaagtccggtttgcagcggttggctaagtttgcgtcacctccaccagccaagaagcagcgtcggtcgacatggaagaagtaatggggg
aggtttccaggcatggagcaacagacgctgatgtcaactataatatagcaggagtgttatcattc