Transcript Name :
Phyca_LT1534537975
Orientation:
(-)
Number of Exons:
1
Description :
late embryogenesis abundantlike protein 1 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
194-268
1-175
176-193
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        922 bases(100 bases per row)
aagacgcgacagttggagctttattttctttccattgtcctcgtcccaaggaattccacttcgcagcactctctcactttgcaacacgccacaaaccacg
gagatcaacgatatcaacatggtgcgaatgcctaccagtatgcccaagagccacatgaccaaagaccgcggagctaaggaagcagcgtccgaaacggtgg
acgaaatgctgtccgaagtggagaagatgcgccgcaaaaacgaccttagcgatcgcagtcgtcgcacgctggaacagcttcaagaagacgctcgcaacct
cggagaatacgctcgaggcaagatggaacacgtgaacgaggtgatgcgtgatgcagctgcttcagtgcgcgagtccagtggactgccgagctccgctcca
gtgccgacagaccccatcagcgacaccgtgatggactctgtcaaggcgacgagcgagaaactcaatgctgagatcaacgaccttggcgaacgcgttgaga
gtatcaaggctcgcgtcgctcagacgatgcaacatgccggtgggaaagcgaaagacacgtggcaccagagcgctgaagcggccaagaacgtcggtgaacg
tgagtactgcctgccactgcccacggatcgcatctgcgctcgacacgtcgcgctcttcggccttccgttgctggtcattttcatgttgatcatgttccgt
cgccgctacccgaagaagtggaaggccagcgtgaacaaaatgaagaagccacgcatgatgctggcgcgcgaggtgccgtccagcgagaagctcaagtcac
aaatggaaggagcagccgacagtctcgaggagaagttcaaatacgccaaacaacaaggaggcgccaagatggacgaggtccgcagcaagtatggccagcc
ggagaacaagaaagaccagtag