Transcript Name :
Phyca_LT153496997
Orientation:
(+)
Number of Exons:
3
Description :
FKBPtype peptidylprolyl cistrans isomerase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain28.973PS50059
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-119
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein foldingGO:0006457IEA
*** None ***
*** None ***
Sequence
        481 bases(100 bases per row)
atgatggagcctaaagactttgtgatctccaacgtggtgcgttgattcttcgtattttccccttgaggctatatcccaagctgacaccaaacgccagcgt
catggagagatccagattgaagttttcgtcgctggcgatggtctaaactaccccaagaaagggcaaactgtggtgatccattacacgggatatgtacgat
ccttcgcttctgtattcgtagttcatctctcaccttccgcttagcttcaggacggcaagaaattcgactcatcgcgtgaccgagagaagccttttaagtt
caaactcggtgctgaacaagtgattccaggactggatgaaggcgtggagcgtttgtgcatgaaggagcgtgccaagctgtttatccctgcagacaaagca
tacggacgtaaaggattcccaggcctcgtgccgcccaacaccaacctcatcttcgacattgagctcttgacattccgttaa