Transcript Name :
Phyca_LT1534537898
Orientation:
(-)
Number of Exons:
1
Description :
U6 snRNAassociated Smlike protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Ribonucleoprotein LSM domain, eukaryotic/archaea-type1.2SM00651
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ribonucleoprotein LSM domain, eukaryotic/archaea-typeIPR006649
*** None ***
InsideOutsideTMhelix
1-107
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K12626
K12626
Cluster Id
2166
Sequence
        514 bases(100 bases per row)
atggcagcgaacggcgcaagtggcggcggcaaccgcaaggaccccattctggacctggccaagtacatcgaccaggaggtgcgcgttaagtttcacggcg
gccgagaggtgacgggcacgctcaagggctacgaccagctggtgaacctcgtgctggacgactgtgtcgagttcctgcgcgaccccaaggacgagtaccg
aatcacggacgagacacgcaaggtgggtcttgtggtgtgcagaggaacgtccgtcatactcgtctctcctgtggacggcacggcagagatcccgaacccg
ttcctgcagcaggagggctaagaacgaaaggcacaagacgaacagcaatccaaaacctttattttttcaaggtgcacacacaacagaagccttttctcta
gataagataccgacatccctattcgtgcttcttgttcttcttgtgtacagtgcactctgttttgcggtatctactgcacaggatctatgagacggacctt
gtagacagccttcc