Transcript Name :
Phyca_LT1534557932
Orientation:
(-)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-138
NN-scoreoddsWeighted Score
0.7915.8820.012
*** None ***
TypeScore
nuclear783
GO
*** None ***
*** None ***
*** None ***
Sequence
        1005 bases(100 bases per row)
ttttcaagcgctgtggagcagttctcgaggtgaggatcgctgctgcatgcatacgacagcttgtcgctaatttgttcgttgttgatttattctagcgcac
tgtcggctacaaagttgcatgttgctgttctggcggtgcgacagtcaacgcgcattcctgggtttcttccgaagcaacagtttaaacttcggctcccaaa
ggacaaacgtggagcacgaacgcactatattacgataagtgacggctctgactgctcggaacaagcctcgaattgcacgaacagcccagggaacggaccg
tccgaagaaattcacagggtggaagcatcaactgacgtgaatttcgtgtggtacgttctggagcaacccatacctggttttaccgaggttatcaacacgc
tcgacagtctctaagcacgacttgaagacgagcgtacgcatccaaaaatattctccagagtgcgctgagatttctgatcctgaggttcattgatgaggac
gaaagttggcaaggaaaagttagcacacttgcggattttattctggaaagatgcagcaagtcccgtcaccgacagcctttgcttcactggaagaacggat
cgcgcatctgaactggagaaaaatctgcaacgagcgggagattcagggcactcttcgatacagcaagcagctccaagaccgagacgagttcattcgcgcc
gctaagagtggcaacaaagccgttcgtgaacggatgcagcaggtgatcaaggacgagttcaccaagccacttcctgtgaccacccagttctacgaggaac
tgacggcgttgcagcgtaaagacgagttaaaggctcaggaagtggccgagagacacatgactcaactgcataacatccaggcgaagttagacgcccgtga
ggctcaattgatgcgtaagaaggagttcgagcggaagaaaagggagttattcgcagggaattaaggcctaaaatcttaacggaatgtcaagagctcaatg
tcgaa