Transcript Name :
Phyca_LT1534524823
Orientation:
(+)
Number of Exons:
3
Description :
glutamyl-tRNA amidotransferase subunit C
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-166
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        856 bases(100 bases per row)
atgatgcagacaactgtggcgacattaagcgctgtccttcgtcgcgctatccggcctcgtattgctcgatacttgagctcttcagctgcttcactacctg
aaggtcttcgtgagatcaccagcgtcccacgaacaccgtcctggtcgcttaaggagctgcatcaggatggagctcagttcgatgctgcggatacagtgct
gacggaagagaaggtggtttgcaattattaacaagctgctatgaagttaggatgctgatacttaacaactctctattgctgattgggactcgcagcttcg
tgaactggcagagctgtgtcatctccacgtggatgacgagaagttaccgggtttgctcaaggacgtggagtccattattcagtgcaccaagaccatccag
gccatgacgttgaacgagaacatcgacgatgtttacgctaagagcgactttgatgcaggtatgtacaggtggaaggaaaagcaggtctttcgtgtggatg
ttgatatctttcattgtttttgtgttgtgtatctaggtgtggtggcccctctccgcgacgacgttgtcacagaaggagactgcgtagagaaggtcttggc
gaacgcagcggagaagtctgggtactatttcaaggtccctaaggtgctacaggactagatttttccagagtcattggcaaacagagaaccatagaagaac
gcagcatcgtgcaaggcaaaatctatagtaagtgcacaaaggaaacgccttgttccctccctatgtctcctaaagcacgacatgtgccaccacaattagt
cgtcagctttgaagacgtcggccttggccaggtactcctccagatctgcaagaaag