Transcript Name :
Phyca_LT1534557900
Orientation:
(-)
Number of Exons:
1
Description :
cyclic nucleotide-binding protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-627
NN-scoreoddsWeighted Score
0.723.1690.006
*** None ***
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        4189 bases(100 bases per row)
cacgaaagcatggtcttatgatctgtttttaggcttcctagagggtaatgaagtatgaagatcatgctcgatttagctcatttgtgctcttcttgtcgtt
atggaagatgcccgagtagtgacagcgccgggtaggtatcgcttgaggacacatgagttagcgcaagtgattcaaccgcgttcgcgagctgcttcctcgt
ctgtcgttaccaatcgagaggatttttgtgctgtctcgcctactaggccacgaggatcaattgctagagcgattactccacctcgaggacgtacagtgct
cgagtccatagcgtttgaccctttcagcaactcggaaagtttcaagtttctgctgcaagatccagaagagagtcgagaaagaagaaaagacccaaaagct
gtcgcggagttccgacaatggcagtcacgccatttcccgcagctcttacgcacattccaagcgttgcatctgatctgcaaagaacaagagccgtcggatc
cccaagaagaatttgacaacagtcaagctgaagaggcagacgaagaagcctggagactgatctttcaacaagcgaccgtgatgtcagcgacgccaggaga
gaaaatcaccatcgagagcatcacgcgaaccgagagcgtgtacttcctgcttaatggtcactgtcagctctcgttccgaccatttcttctacgggatagc
aagacacagtctcctgccacacatttacgagaacttgtagctggtgattgcttcggactcgatgctgcagcgttcggctttgagtattctctgtctactg
cgacggcagatagtgcacgacaacgtaatgttttgggactccgagaggtggcactcacccacgtgttgtgtttaccctatgctgtcgttcagcagctcca
gcaccgacatcaagataacaacatccatttgtcaccaacctttccgttcgcctttgcaccagaagcggaggtgtttctacgcaacactttcctgtttcga
tccatggcagactcatctcgacgctttctggcagcacacatgactctgcgtatgatcgcccaacaagaatatctcttcacgcctggccagcctgtgcgag
tcttcatcgtgaaatcaggacaacttaccctcggatcgcctcgagaagaccgtcatggacggacagaagcagagttggagctagagcttctgcaggctta
cgattccgttggactagcggaaactttacacctggagacgtcatttgacagatactgtgcggtgacttcagcaaacggtgcacgagcttacgagttaccg
tcgacggtgctgctcatggttctggcgcaagagtcatcgacactgaagatccttcacgagtggatcgcccaccggaagtcttggtacgaactgaggagag
ccacagcattagctcaacgaaagcgattcactggggaaggttctgagcacgttgtccggttaacatcggtagctcagcgacgcagtaaactgacctgctc
tcgctgcggctggacaggtcatgcgtcaacttcatcgtcctgtgtgcgtgtagatatccctgtcagcgaatctccagctttaccaatgttacaactcgat
aaaagaaaatcacgaggaagtcgagcagcgagggagcaggcacgaaaggccgaacgtctgcgctctactagtattccggaatctgatgacaccacacctg
gtcagcagcaacacttctctttcagcttcagcccaactagtccacgaaaaacaccggcacaccgtcgtttacaggtcaattcgatagtccttcgagggtt
gcagatatctcgaatttccatgatggaacgtcttcaatcggacacaccggcaagcagcgaaacgaacactgacgtggaagaccaccgaaacgtgataaat
acaagcagtaaggaagatgccttacgcagttgcaaactgacacagtcactccgacggctggagatagcgctacaacactaacaaacgtcaccagcccagt
aacaccgataacttgcacattccttcacatcagttcatgcattacctgtcagctctcggcaaaaacccgtggaattgaagcgtgtacacaatttctatct
gcgtcgccgtttcttgctactgcccttggattttcgtgaactgcttgccttctgtttacccagagcacctttaagcggctcaaaaacgctttgaccgagc
ccaaagtgcttgtcctcattgtagggcgacccgtgaagttgatggagatgccgtcggtggtagtacgcaatcgggatggctggggtatagcaaggcttct
caaattcatttgtgggaagcgaattgccagcatcgtcacattcacttgggaattcttttgacgggctctgtatggtgaacacatcaacgggggcatgttg
cgcaatttcagtaagcctctccttctcaagttttcgctcttctgcgtcgcggtcaaatacgtccaaatgcagctcgttatcagtgataagtcgaaagccc
gctgggtacattgctcctggccacgttgtagtgaattgctcttcaatcacgtgcaaagctccgctcgtagaaaccgccaacacgctctgcctcatacggt
cccaagccagagctaacacgccatcttttactccaacgttgtgctgtgcagttgtccgtcgtagtaccgaggcacgatgccaagtaaacaagccgttctc
acctacgtgtcgatgacgcacgactggcgtaccgaccacgaactcttcgccgccgctaaaacagcaaacagcccagggtgcacggactgcaccggtagaa
tgtagcgccacctcacgcagacctagtggatgctcctcagtcgcagttgctgtcacttcagcagagctgtcgtccgatgttgtaaattctattgcggagg
tcataacaaactcgtgaattcccttcgagctggttaccaacattgctgtttcacgcaagtttacacatagatccacatactgtatgatcacagtcagctt
gaggctgtcgagacactgcaaagttgcagcatccagtattgccagagtcgatttggacgtagcgcagtaaattcgctttccagagcgtccatatctcgca
caggacgcaagaacagggtgtcgtgagttgctttgtggcgtgggctgagcaacctcagaattttctagcggaacgtttccaagctccttacgttcacccg
agacgacgtccagcagcaccgggggagagttccaatagcttacaacaacaagctttgggtcaaaagggtgcggactcaaggcggtgatagttccgtcaaa
ccgaaacgccgacacgagcgtagccgcatcaacatcccatacacagagtctcgctcgtcgcgtggacttctcttcgcatcctgcaaaaacccatcgcgaa
tcacaggaccacgtacattgcgagaccacctttagtgccgtcttcgccactctaagatccgacaacgtcaatacagctccaccccccaaggtatcatctt
caccctcagttttggtctcttcactggtgttgagcgcattatcctcctcagcgtctgcctcgtcttcttcctccgttgctgcctcctcctctactgaccc
tgcatcttcctcttcttccgcagatacgtcgtcagtctccactgattcatctgcggtattcttccccgtttcattgttagtagtgggcgtatttaactca
tcgaccttctcctctggagactcaatggcaatgagcgtggggtccagctctcgtgtgatcacacgaatactcgtgttgtcccaaatagtaacgcggccgt
cgcgctcgcccaccgcaatgagcgtcatagggggattcaatgccagacaattagcctgctgtgtatcttcaaggcagctccacgacgacgtgggtcgcga
cagtaggtgcttctgcaaatagtcatcatcgtcttccattccttcggcacgtgcagcctcactaatagtctccggtgctgcattacagtcaatcttgggc
gtaatagcgggattgtcactttcagacgcggattgtggagcttctacgagggtttcagagctcgtatcgactgtattcgatgcgcacgacgctgcggaag
aagcgtgagctagttgctgctgccgccgatcggcctgctgctgctcttcggcgtgcacaactcgccgcaacgcctggttccacattatc