Transcript Name :
Phyca_LT153471195
Orientation:
(-)
Number of Exons:
2
Description :
PREDICTED: retroviral-like aspartic protease 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-155
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        513 bases(100 bases per row)
atgcttgcggacactggagctacgctgagtctggtcgacagccgcgtgttgaagcggttgggacggtcgtcgaggacgcttagaccatacgaagggctag
tgaagagttcgtctgggcatccgttacggattcatggctggatcggtctatcgttgcggttggggacggtggagataacgctcgacgtgctggtggcgga
ccgtctacacgtcgacgccatcctaggcgttgacgcccttggtgccttaggtgctgtgattgacgttgcggaacggtgcttgactttgaaaggaaccggt
gaagtgctgccgttgggattcacggttgtacaggacgcttacatggctgtgatgtcggttcggctgccgccgcgaggacaagctttggcgatggctaacg
tgattggagggacggtcgataagaagacggttttggtcgaaggagcgattgggttaccgcctacattgtgcgtggcacattcgttgggcacggtcgaaga
aggtcaagtcatt