Transcript Name :
Phyca_LT153497171
Orientation:
(-)
Number of Exons:
3
Description :
NADH dehydrogenase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
4Fe-4S ferredoxin-type, iron-sulpur binding domain9.869PS51379
4Fe-4S ferredoxin-type, iron-sulpur binding domain10.743PS51379
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-202
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00338
Cluster Id
4261
Sequence
        769 bases(100 bases per row)
atgctgcgtcgatcggccgcggctgtagccgccaagcagactctggccaaggctggcagcgctcgtggcttcgcgaatgtacctgctcctggacagctgg
acccgaagcccacgtggggcgaagtgatcgagaagatgtccgacactttcttcctgtccgacgtgttccgtgccacctggttgtcgtgggaagtgcacgt
ggagcgcaaggttaccatcaactacccgtacgagaagggcatgctcagcccgcgtttccgtggtgagcacgcgctgcgtcgttaccccagcggcgaggag
cggtgagtgcacaatctcgttctggtggtccggccagttaaaggaagagtcgcgttctcattttttaacactgacttattactgcagatgcattgcctgt
aagctgtgtgaggctatttgccctgctcaggctatcaccattgaggcggtgcgttgttaagtggatcttttgggggaatgcgaagagagactgatagtat
ttttttacttattgttgatgttacaggaaccgcgtgcggacggtgcacgtcgtaccactcgctacgacatcgacatgaccaagtgcatctactgtggttt
ctgtcaggaggcgtgccccgtggacgctatcgtcgagggacccaactttgagttcgccactgagacccacgaggagcttctgtacgacaaggctaagctg
ctctccaatggcgacaagtgggagttcgaaattgccaagaacctctccgtcgagcagctctaccgttaa