Transcript Name :
Phyca_LT1534537925
Orientation:
(+)
Number of Exons:
2
Description :
cholinephosphate cytidylyltransferase B putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-252
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00968
K00968
*** None ***
Sequence
        937 bases(100 bases per row)
aagcagccattccagctttatcccagcacagaacaagcctaagcagaaaccccttcaagacatggcaccagtgcgttagaatcctaaaccttgctctgaa
tctcaatagcactgactgtggatgtattgcagtccgcttcagaaacgaatgacctgtctaagcaggagttaggactcaaccctggaggaagtgatagcgg
gaccaacaccgactcgaccagctccggaccgttccgcaagacattggaagaaggcgagcctggaacgctaactggtcgtccccttcgtctctatgcggat
gggatctttgatctcttccacttcggacacgccaaggccttacagcagtgcaaggaggcgtatcccaacacgtacctcattgtgggctgttgcaatgacg
aggtcacacacagactcaagggtcgaacggtcatgacggacaaggagcgctacgaatcgctgcgtcactgcaagtgggtggacgaagtggtagaggacgc
tccgtgggtaatcaccgacggcttcctggagaagcacaaaatcgattacgtgtgtcatgatgcgctgccgtactcggactcgtctggtgaagctgctgaa
ggagatgtctatgcccgaatcaaggcgatgggcaagttcctggagacacggcgtacggatggcatctcgacgtcagacctgatcatccgaattgtttccg
agtacgacactttcatccgccgcaacttgcagcgcggatacactggaaaagagatgaacgtggggttcgtcaaggagcacaccatcaagcttgacatggc
ggtggacaaaataaaggagcgctttaccagcattttcagccgaaaaccgggtagatacgatcagcggcagtctgtataaacggatgctgctttagaatgt
tgacaacaacctcaataaagaccacagttcaactgtc