Transcript Name :
Phyca_LT153497173
Orientation:
(+)
Number of Exons:
3
Description :
mediator of RNA polymerase II transcription subunit 6
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-242
NN-scoreoddsWeighted Score
0.8795.2120.01
*** None ***
TypeScore
nuclear783
GO
*** None ***
*** None ***
*** None ***
Sequence
        854 bases(100 bases per row)
atggaggtggcggcccacactgacgactacaacgcgtcgttccgcgacacagtatggctgcagtcgtttccgctgaacgcgcagacggtgttgcactact
tcgcgctgtccccgttctacgaccggtcgtgcaacaatgagcgcctgaagatgcagcgtttgggcctcgaccagctcaaaaatctgcgcggcgtcgagta
cgagctgctccccaacgcggccaaacagatgccgcagcagctttatattatccgcaagcagcggcgtaatgggcggactcaagtggaaccactggccatt
tactacgtgctggatggcactgtttaccaagctcccaacatccacgccatgctaacttctcgccttgtatggatacagtctgaataatgctagagttttt
atgctgactaactatactgttatgtatttatggcagaaaaaatgcagttacagggtgaacaaggccttccacggtctggcggcgggtgtgcgcttcagcc
ccacggagggctacgcgtgggactttagctccaaggacaagaaggagccggtcatcccttccgagcgtgagttgttggaacgtgtgtgtgtttctgccat
gtcgctaattcgtgctgcctgtagagctgcagctgaagctcaagcagaagtacgagaagatggagaagcagcgcgaaaactcggcacgagtggattccat
tttgattcagctcatgaaaaagcacgcgccggagatcgcagagaagttggaaagcaacagctctgcaggagtagcaggagcagaagacccagcagcggta
aagcgagagagcgataccgttgcagagacttccaagaggcagaaagttgcttaa