Transcript Name :
Phyca_LT1534557906
Orientation:
(-)
Number of Exons:
2
Description :
Kojibiose phosphorylase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-189
NN-scoreoddsWeighted Score
0.8365.6670.011
*** None ***
TypeScore
mitochondrial565
GO
*** None ***
*** None ***
Cluster Id
5087
Sequence
        646 bases(100 bases per row)
atgagtcgaggacgtggccgtggccgtgtgcgctttggtggcagtcgagactcgatgctggcggatatcatggacgaaacgcgtgaggatttggggcttt
cacacacgcagatggagctgctacacgtaggcctcgatggtcgttcctttattcataaattgcactgtattaacaattcctttgatttcattggtgaaac
tacaggcggaagctggtgcatcactgtatccgcccatggagctaccgcagcctgaggctttggccgatcgcgacgcctatttgatccaaagacagcgtat
tttggcacacaaactcgaaagtctgtaccgcccgtgggaagcggacccgacaggcccagactctggacgcaatgcgtccgatccagcagctttcgtgcat
gtgacggtgccggagacgcagaaggccaatgagatctacgtccccgaggagctccgtgccaattcgcttagtggactacgcacgtcagcagcaggagcga
ttggtcgcggcattatgcagccacgtgcgtttgagaatgtgttcaagtcgttagaagctcaagagaagaaaattgcagcagataaggccaaggcggccgt
gcaggaggcagatgatggtgacatggacgacgctgaagaggacttg