Transcript Name :
Phyca_LT1534502575
Orientation:
(+)
Number of Exons:
2
Description :
unnamed protein product
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
33-51
98-109
155-166
217-255
1-9
75-77
128-136
190-193
10-32
52-74
78-97
110-127
137-154
167-189
194-216
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        992 bases(100 bases per row)
ccacaaactgaggagctaaaggcaacatgtcgatgcagtcgctggccaatgccgcctacatgacgtacttcctggcagccaaatcggtgcctgtggtggc
tgtaggctcgtccatcgtgttcgccatctctccctggtgcgaacgcgctcttttatccccacaaataccagttgactcactcaattcccctcctacaggc
ctaccgttgccaccatccgccgctcacgcagtacgctgcagttctcgttcgccccgttcttcttctacttcgtgcagagcgtcatctacactttgtatgg
ctggacgacgagcaaccccgtggtgggcggcacatcgctgctcggtgttgtgttgggctcgtactacgttctggtcttctacaagtacgcacacgaccgc
acacaagccacgcggatgttgacgtcggctatgctcgtgatcttcttgctggcttaccaagtggtgacgcgctcgcccgaggagacgcagatgatcacgg
ggattccggccaacatcctgtcggtgttcacagccgcctcgccgctgctgcaggtcaagaacattctgcgtcgtaaggacgcgtcctgcttgccctttgg
catgtcagccatgaatgtcgtgtctggatccatttgggccacgtacggtgtcatgctgggcgacccactcgtcatctgccccaatttgttcgcgctcaca
atgggtgccattcaggtgtcgctgatcatgctctacccgggaggcaaaggggccaacaagactgcggaaccgaaagccaagtcgtcgcctcctacgaagc
cagtgaagaagtccagccctcgccacaagaagaaagctgagcacccagaatgaagagggataatccctctttgacacggtgtaagctgtatttttttgag
gatgctcgtgttattttggggaatacggagagtaacaactaggaagcttttactcagcaatcatgatggagcctaaagactttgtgatctcc