Transcript Name :
Phyca_LT153496550
Orientation:
(+)
Number of Exons:
4
Description :
methylosome protein 50 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat9.74PS50082
WD40-repeat-containing domain18.457PS50294
WD40 repeat12.213PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat9.6SM00320
WD40 repeat0.0047SM00320
WD40 repeat5.1SM00320
WD40 repeat10SM00320
WD40 repeat340SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-296
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1055 bases(100 bases per row)
atggctccgcagcaccctgccttcactgcggccgcacaagttgacgccctggccgcctgctccctgccgaatctgctcttctcggacgaagatgacaacg
tagaagagccggagattccgctgctggctgtggcgcagtcgcagctcgagggaaacgtgtggaacggaggcgtggcactgctggatgcggccacgagcga
gcgactgtgcgagttgcaattggaaacaggcgtcgggtctctagcttggtgcggtctagatggagatgtgttggctttgggctgtgacgatggcgacgtg
cgcttggccaaattgtcgacggatgttgctttcgcctttgtgcccattggtacaagcaacgaagacgcagtaggtggatggggacacgacgatgtcgtca
cgggcgttagtgtatcgagtatcgagaagacgcaactggccacaagtagctgggacctcacgtacgtctagtgagctggtggggactgggactgttactc
taatggagtttgtgaattgtgtacagagtaaagctctgggatatcaatgcaatggacaaaacagtcgctacttttgacggtaagtgggtagagcgaggtt
agagatcggtgtcttagtgctaagtgatgttgcggtactgtttgcagggcacaccgacttaatttggggtgtggcgatgaacccgacccacgcgcatgta
ttgtgctcatcgtcacaggacaccacggtacaggtgtgggatgctcgtcgtcctcaaagtgcagcgttggtagtgtcaacacttcttcctgctttgtcag
tggattggcatccgaggcagccgactgtattctccgtcggactggatgacggcatggtgtgtacctttgacgtgcgctcgccacacactcccctagcaag
acgagagacgcacagagctgcagttcatgcggtcaagtactcaccatatcacgaagacttgctggcgacgggaggtgacgatgggaagacgttcgtgact
accgacagcttctcttccgaccgaactgcaaacagtggtgttcgtgaaatgctga