Transcript Name :
Phyca_LT1534502542
Orientation:
(+)
Number of Exons:
1
Description :
expressed unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-165
NN-scoreoddsWeighted Score
0.8945.6910.011
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        1122 bases(100 bases per row)
catagcgcaatttgcttcaagccgcaacaacagacttcaagaaacttcaagatggtgtcgtcacctctgccttcgtcgacgctggacgcgttggcgcccc
ctttctacccgtccatgacctggtacccgtccatcacggacgactactacctggagcgtccgcactcgcccggcaagtcgggctttgtgatcgctgaccc
agtggagcccatggcggagatcccggacgaggagctgttcgaccccgcgttctacccgctgtcggccatggagatgcaggagctggaacaggtggacgag
atcaatgagattctggccgagctggacctgatggaaagccaccaggagctgcactacaagctcagcgagaagacgcgcgagctgcgctccagttcggacg
tggatgcggagatctacagcatgatggccaaggcgtccaaggcgaagaacttctcgaagcagcacgttcatctgcacaagaataccagcttccactctaa
acgcaacatgcgttcagcgctgcaccagccccgctcggtgaagtagagccctcacacgtcagtgttttgacgtgcggcggcacctatttcaacgcaacgg
agtgagtgagcaacaagcgacggcgatgtcttgaaagacacgcgcatctattcagaaaaggaagaaaatcgcgctccatctgactcgaagaagagaagag
aaaaactaccatccagctagtcggagctttggtacttgtcctgtattggcagggtgagtacgagcttcgatggccacaaaaccataccaccagcggacac
ctcgtgctacagaatgtcggcaaaaataccaagtagcaaaagatagcagaaaatagttaagcaagagagttgaggaagtacggcatgaagacgagcaacg
agcgagcgagcggcacgacgatgagactgggacaagggacttctgaacctaatggcatccgatagaaggcaagccgaccccaagcagaagttgaaggacc
ttttccacctcgttgcggtgtcgtgaaagcagcgttaactgtgaatcgcgcagtacgagtgtaccaatacccagaaaaattataatacttcgaagtaatg
taagatggagcgagcttttttc