Transcript Name :
Phyca_LT153496811
Orientation:
(+)
Number of Exons:
2
Description :
PREDICTED: B9 domain-containing protein 1-like
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
B9 domain33.186PS51381
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
B9 domainIPR010796
*** None ***
InsideOutsideTMhelix
1-162
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        544 bases(100 bases per row)
ccgggcgtcacgaacgtctattgtcgatatacgatcacgtacggtgtcgactggcgcgtactccatgtgagtttagctagaaggtaggtggacagctttg
aaattgacaactttgatgttgcagggagctgagaacggcctctctcagatcgcatatgtagccaaccatgaggatgaaatcctgctcaacttccctattg
acgtctcgtttaagagcacaaacccatttggatggccgcgactggtacttagtctctatggacttgacgctttcggacgcgacgtggtgcgaggctatgg
ctctgtagtatttcctgttactccaggctgctttgagcgtgaagtgcctctatttcgcccaatgtcgtcatcggtcgtgcagcagtttgtggcctggata
actggttccccaccggaatactttgactccaagtttgttgctcaaagcgacagtcgcgacgtaacacgcgtcacttctgcaggcaaagtacgcgtccttc
tgaatgttgctacgcatggaatgaaacaacacgggtacacataa