Transcript Name :
Phyca_LT1534502546
Orientation:
(-)
Number of Exons:
3
Description :
unknown
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5160.72318
InsideOutsideTMhelix
22-46
1-3
70-77
4-21
47-69
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        502 bases(100 bases per row)
cggaatatgggcgtgttgtggaactttgtgcttacgagcttgttgctcaccaacgctgtgtgtatcctgcatgagaagaggttcctgcgtccgcgtacgt
tgctgtgatgtattttaacgctgtgtgctgtttaaaatattaacctgttcgtgacgaatgcagacggatggcacaaggtggactcgtcgcagggaatgac
gatcaagaaccagatcgtgggcttcctcattgcagtgcagtatctacgatgtacgttcagtgctgtggttgttgttgattgcttctgttgatccggataa
tatggttgttacatggttctcacgctttcgcccgttttgtttcgctcgtattgtattcagtcccgctcatgatcatcaacacgctgatgatcttgttaga
gctcgttatgggctgaagctcgacagagtctacgtaattaaaactatgcagctacagttggtttcttctcaactatcaatccagcatttgcatcctcgtg
tc