Transcript Name :
Phyca_LT1534557899
Orientation:
(+)
Number of Exons:
1
Description :
WD40 repeat protein, COMPASS complex protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat5PS51257
HmmSmart predictionP-Valprediction_id
WD40 repeat0.63SM00320
WD40 repeat12SM00320
WD40 repeat240SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-697
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
5034
Sequence
        4189 bases(100 bases per row)
gataatgtggaaccaggcgttgcggcgagttgtgcacgccgaagagcagcagcaggccgatcggcggcagcagcaactagctcacgcttcttccgcagcg
tcgtgcgcatcgaatacagtcgatacgagctctgaaaccctcgtagaagctccacaatccgcgtctgaaagtgacaatcccgctattacgcccaagattg
actgtaatgcagcaccggagactattagtgaggctgcacgtgccgaaggaatggaagacgatgatgactatttgcagaagcacctactgtcgcgacccac
gtcgtcgtggagctgccttgaagatacacagcaggctaattgtctggcattgaatccccctatgacgctcattgcggtgggcgagcgcgacggccgcgtt
actatttgggacaacacgagtattcgtgtgatcacacgagagctggaccccacgctcattgccattgagtctccagaggagaaggtcgatgagttaaata
cgcccactactaacaatgaaacggggaagaataccgcagatgaatcagtggagactgacgacgtatctgcggaagaagaggaagatgcagggtcagtaga
ggaggaggcagcaacggaggaagaagacgaggcagacgctgaggaggataatgcgctcaacaccagtgaagagaccaaaactgagggtgaagatgatacc
ttggggggtggagctgtattgacgttgtcggatcttagagtggcgaagacggcactaaaggtggtctcgcaatgtacgtggtcctgtgattcgcgatggg
tttttgcaggatgcgaagagaagtccacgcgacgagcgagactctgtgtatgggatgttgatgcggctacgctcgtgtcggcgtttcggtttgacggaac
tatcaccgccttgagtccgcacccttttgacccaaagcttgttgttgtaagctattggaactctcccccggtgctgctggacgtcgtctcgggtgaacgt
aaggagcttggaaacgttccgctagaaaattctgaggttgctcagcccacgccacaaagcaactcacgacaccctgttcttgcgtcctgtgcgagatatg
gacgctctggaaagcgaatttactgcgctacgtccaaatcgactctggcaatactggatgctgcaactttgcagtgtctcgacagcctcaagctgactgt
gatcatacagtatgtggatctatgtgtaaacttgcgtgaaacagcaatgttggtaaccagctcgaagggaattcacgagtttgttatgacctccgcaata
gaatttacaacatcggacgacagctctgctgaagtgacagcaactgcgactgaggagcatccactaggtctgcgtgaggtggcgctacattctaccggtg
cagtccgtgcaccctgggctgtttgctgttttagcggcggcgaagagttcgtggtcggtacgccagtcgtgcgtcatcgacacgtaggtgagaacggctt
gtttacttggcatcgtgcctcggtactacgacggacaactgcacagcacaacgttggagtaaaagatggcgtgttagctctggcttgggaccgtatgagg
cagagcgtgttggcggtttctacgagcggagctttgcacgtgattgaagagcaattcactacaacgtggccaggagcaatgtacccagcgggctttcgac
ttatcactgataacgagctgcatttggacgtatttgaccgcgacgcagaagagcgaaaacttgagaaggagaggcttactgaaattgcgcaacatgcccc
cgttgatgtgttcaccatacagagcccgtcaaaagaattcccaagtgaatgtgacgatgctggcaattcgcttcccacaaatgaatttgagaagccttgc
tataccccagccatcccgattgcgtactaccaccgacggcatctccatcaacttcacgggtcgccctacaatgaggacaagcactttgggctcggtcaaa
gcgtttttgagccgcttaaaggtgctctgggtaaacagaaggcaagcagttcacgaaaatccaagggcagtagcaagaaacggcgacgcagatagaaatt
gtgtacacgcttcaattccacgggtttttgccgagagctgacaggtaatgcatgaactgatgtgaaggaatgtgcaagttatcggtgttactgggctggt
gacgtttgttagtgttgtagcgctatctccagccgtcggagtgactgtgtcagtttgcaactgcgtaaggcatcttccttactgcttgtatttatcacgt
ttcggtggtcttccacgtcagtgttcgtttcgctgcttgccggtgtgtccgattgaagacgttccatcatggaaattcgagatatctgcaaccctcgaag
gactatcgaattgacctgtaaacgacggtgtgccggtgtttttcgtggactagttgggctgaagctgaaagagaagtgttgctgctgaccaggtgtggtg
tcatcagattccggaatactagtagagcgcagacgttcggcctttcgtgcctgctccctcgctgctcgacttcctcgtgattttcttttatcgagttgta
acattggtaaagctggagattcgctgacagggatatctacacgcacacaggacgatgaagttgacgcatgacctgtccagccgcagcgagagcaggtcag
tttactgcgtcgctgagctaccgatgttaaccggacaacgtgctcagaaccttccccagtgaatcgctttcgttgagctaatgctgtggctctcctcagt
tcgtaccaagacttccggtgggcgatccactcgtgaaggatcttcagtgtcgatgactcttgcgccagaaccatgagcagcaccgtcgacggtaactcgt
aagctcgtgcaccgtttgctgaagtcaccgcacagtatctgtcaaatgacgtctccaggtgtaaagtttccgctagtccaacggaatcgtaagcctgcag
aagctctagctccaactctgcttctgtccgtccatgacggtcttctcgaggcgatccgagggtaagttgtcctgatttcacgatgaagactcgcacaggc
tggccaggcgtgaagagatattcttgttgggcgatcatacgcagagtcatgtgtgctgccagaaagcgtcgagatgagtctgccatggatcgaaacagga
aagtgttgcgtagaaacacctccgcttctggtgcaaaggcgaacggaaaggttggtgacaaatggatgttgttatcttgatgtcggtgctggagctgctg
aacgacagcatagggtaaacacaacacgtgggtgagtgccacctctcggagtcccaaaacattacgttgtcgtgcactatctgccgtcgcagtagacaga
gaatactcaaagccgaacgctgcagcatcgagtccgaagcaatcaccagctacaagttctcgtaaatgtgtggcaggagactgtgtcttgctatcccgta
gaagaaatggtcggaacgagagctgacagtgaccattaagcaggaagtacacgctctcggttcgcgtgatgctctcgatggtgattttctctcctggcgt
cgctgacatcacggtcgcttgttgaaagatcagtctccaggcttcttcgtctgcctcttcagcttgactgttgtcaaattcttcttggggatccgacggc
tcttgttctttgcagatcagatgcaacgcttggaatgtgcgtaagagctgcgggaaatggcgtgactgccattgtcggaactccgcgacagcttttgggt
cttttcttctttctcgactctcttctggatcttgcagcagaaacttgaaactttccgagttgctgaaagggtcaaacgctatggactcgagcactgtacg
tcctcgaggtggagtaatcgctctagcaattgatcctcgtggcctagtaggcgagacagcacaaaaatcctctcgattggtaacgacagacgaggaagca
gctcgcgaacgcggttgaatcacttgcgctaactcatgtgtcctcaagcgatacctacccggcgctgtcactactcgggcatcttccataacgacaagaa
gagcacaaatgagctaaatcgagcatgatcttcatacttcattaccctctaggaagcctaaaaacagatcataagaccatgctttcgtg