Transcript Name :
Phyca_LT1534524845
Orientation:
(-)
Number of Exons:
4
Description :
39S ribosomal protein L24 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
KOW1.9SM00739
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
KOWIPR005824
*** None ***
InsideOutsideTMhelix
1-167
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K02895
*** None ***
Sequence
        900 bases(100 bases per row)
atggcgactcgtatcccgcttgccttccgtcgcggcccacgcaccaagaagaaagcgatcgatctcatcaagaactggcacatcttccgcggcgacaagg
tgcgtttaaacggattaaaacgtctctgtattgagagaaaaatcgcttttactaactccatcttgccgctctgcaggttgagatcatcgccggaccgcac
aaaggaacccagggcgaaatcgtgagcgtcgtgcgcgaccagaacaaggtcattgtggagaatgtcaatatggtgcgttggagcgtcgttctatagatct
ggaacagtagcaattgacatccatgctacttttgcattgcagtcccaccgctacgtgaaggcaacgcccgctgcttccggtcgttcgtacctgtcaccgt
ctcccatccactacagcaacgtgaaccttgtggacccgtccattggcaagcccactcggattgccatccgcttcacggacgaaggcgaaaaggtgcgcgt
gtccaagaagacgggcactattatccccaagccggaggttctcaaggaacgtcacaacccgcgacgaacaggttcgttagtgtcattcgttcttgtgttc
ttgaagttagctaacacgttgttgtcgctttcgtttctttcagaaactggccccttcgacacggcacccgaggacgtactggaacgcactgtcgaggact
gggaggtcactcgtctgtaggcgtgagtcagctccaagccattgtgatgaccatagtgaaccgcgcagatataggaagagatggaaggcgttggactgca
agcggaactacggcgaatgtgttcgagataatgatagaccagctgaacaggagcaggaacactgccgttgtcgcctaatttcagtttgccctcacgtaaa