Transcript Name :
Phyca_LT1534502583
Orientation:
(+)
Number of Exons:
1
Description :
PF03961 family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-151
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1241 bases(100 bases per row)
cttgctggccacgacgcacacagactcagagacttctggtagccccggtccgttccgctcggaccccgccgctgctagtccagacagggaagcatcaatc
cacgcacatcccccagacctcgcgcggcagtgcagttagagcacagggagtgacagggagagctaggagagagagctaagagctagaagagcaaaagaga
gcaggcatggagattgccaagaacgtacgcgactttctggtcggcatgaaggaggcgctgtcccccgaggaagaccagctgctgtcaagcttgcaaacat
tgcacgaagaatacctcaacatcatggagaacttcctcgcggagttgaactccagtgcgctgaccgtgagccccgaggcgcgcatggttgcgcacaacct
tcgcctgaagatctaccaggattggcgcgccaaactgatggagcgcgtgtttgacaactcgatagagaacgtgtcggccgaagacgcggaatcccacgag
gatggttgcgactgctgtttctgtgaactgaagcagcggttgcgaatgtacgagagcgtgatggcagactacttcgcagcaagtacaaagatcaagagcc
ctgagaacgacagcagcgaggacagtgtctttaagatgccggagttcctgaccacgtagacgctgcgcggtcaggcacgcaaagctagttagggatttct
cggcagcgagtgcgccgggaacgcccgcggatctcgtgtggaacgaagagaaggactgcatcgcgagatgggaccgcccccgcgccttgggccccaagtt
ggggaggctaccgagcagtacaatacgtggaactactacaacaacaagaagaagaagaggcgctcgtgcagcgccgcgatcgtggaagtcgcggcaccgc
tgcgcgagcgaatgggtgtgtgtggaacaatagagtgctccgactgggtcttggccgtcaccggaagcgcgtgcatttcagtcggtagtggtattatgat
ccccccgcctcgatgcgcaggtttataagcaagtttataagtacaaagggctcgtttgaatcattcgcaataggctagcgtagtggcaggggggaaggat
tgatgtcagcagattcgcgccgtcgccattgccgcaccccacgcctcgctgcacacgcgccagcacaggaggaaacgagccaagcagaagagtacgagcg
cgtgcgcataacttgccaagaatgcagagagcttcagacag