Transcript Name :
Phyca_LT1534537964
Orientation:
(+)
Number of Exons:
4
Description :
conserved unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-233
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K03004
K03004
K03004
Cluster Id
4089
Sequence
        1078 bases(100 bases per row)
atgcgctactcggagccgctgcagggcgttgtgttgagcttcagcaatgtcaaactagatcgtcctcacggtgtcattgtgaacgagatgccttttatcc
actgcaaagtgctggccgatgcactgctcttccgacccaaagagggaatgatgttgcgtggtgtcgttaacaagatcggaagtaaccacgtcggtatgct
ctttgccggtgttttcaatggatcggtggcggaagcggagctgcccaagggatacgtgcacaactacgcccaggactgctggtatgttggttcttgtcat
gtcttttgataagttagtgctgtattattcactggttgtttctgtacaggctgggagaagacggttcctctatctccgtggaggatgaggtcgaagtgaa
ggtgctacggtgagtcaacggctgtgatgtaaggttattgctatgaagagtactgatacagaggtattttatcatgctatagtgtgcacgttgcaggtgc
tatggtcgccattgaagccaccatgcgtttcaacggtgctaacgttgtcaaggctacctcaacgtcgacagtgaagaaatctacacacttgaatctcgct
gctgaagagccggagaccaccacccctgtgaaggagaagaaggagaagagggctaaaaaatccaagaaggttgttgagaccgagaagcccgcggtcttgg
atcttgctgctgatgagcctgtgaaggaaaagaagtcgaagaaggcgaaaaagattgtggaaaccgacgctaacgacgttaaaactacatcatcgaagaa
gaaaaagacgcttaaccttagtgctgatgaaccggtgaaggagaagaagtccaagaaggccaaaacggttgtcgaggccgaggcggtggtagaagtgaag
gagacaaaggagaagaaagccaagaagcgcaagcacgacacccccgtcgaggaggtagcagaagaggcagcggcttccgttgaacctaagaagcacaaac
acaaggacaaggacgccaagaagaagaaacacaagaagagcaagcacgagtagactaacacgatactggcgctaggct