Transcript Name :
Phyca_LT153436571
Orientation:
(+)
Number of Exons:
2
Description :
GH19721
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Armadillo230SM00185
Armadillo93SM00185
Armadillo130SM00185
Armadillo0.21SM00185
Armadillo0.59SM00185
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-428
NN-scoreoddsWeighted Score
0.5770.9880.002
*** None ***
TypeScore
cytoplasmic565
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
4609
Sequence
        1365 bases(100 bases per row)
gcgcgcaagcagatctcgcaggagacgttcgacgaatgcgtggcggagaatgtggaggacttcgacatgtcgttggaggaagcagtggctgacgctgtgc
agcagttcgagtcgcaaggcgtggatctatccaacattattaagactggagggtccaaaggccaggaagcgctgcctgctcgtctgaaacggttggtttt
ggagctgcaggagatttcaaagtcgaggagtgaacagaaccaagtgctgagtcttattgctgagctaaagagcgtctgtgaagaagttccggaggcgcgt
gtggtggctggacggaacgacgcagtggacacactactgacgctgctggacgcagattccgataccgtggtggcctcctgcagtggtttgttgatgttat
tatgcgcagataatacagacaaccaggactttgtaggttgtgcgggaatgcagcgacttgtggaggtattaaagcgtcaatttgaagatacggagacggt
ggttcgacttctggcgctggtgaaggcagcgtgcgtcaagcacgagagtaacaaagctcattttaccaagttcaacggcgttgaagcattgtgtaaacat
ttagacagagctgaggaaaatatagcgctgtcgaagcaattggcgctatgcttccgagtgctaactatcaacgacgatccgagcgcgaccttttcgcaag
cacaagacaccatcaaggctctggtcgaacgcgacttgattccgtacacttttgcggttctacgtcaagttaaatctggcgatgcagcaaatacggcctc
agatctactcgtcaattggcttgcagtactcaagcagcttgctgtgacggaggaaaactgccaacaaattgccgatttcgatggtttgactaccgtccag
gaagtgatgaagacataccaacacattgcgcccgttgccaagcggtgtatcacagttttccggaatgtggcagcggcggatgatctcaagcgtgtaattt
tgcagtctggaggtgttgagcagattttgttggtcatgaagcggcatgaagctgatgcttcgatccagcaaaatgcatgcgccacgctagctgccattgc
ccttcgctccccagagaacagtcgtgcgctagttgagcttggggcgattcgtcaaatctcgagggctttacaggctcatcgtagtgacgtagctgtgttg
cgccaagccagcttggctgtgcgtaatatggcggcacgcagtgtggatctgcgctcgcgcttcttgcacgatgaacctgagattgagccgttgcttcgag
aggcacagcaatatcggggctgcggtgacgaagcctacgcagctctgcgtgacttgggctgcgac