Transcript Name :
Phyca_LT1534502557
Orientation:
(-)
Number of Exons:
3
Description :
ubiquitinconjugating enzyme E2 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin-conjugating enzyme, E246.877PS50127
HmmSmart predictionP-Valprediction_id
Ubiquitin-conjugating enzyme, E21.9SM00212
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-154
NN-scoreoddsWeighted Score
0.8365.1640.01
*** None ***
TypeScore
nuclear826
GO
*** None ***
KO ID
K10573
*** None ***
Sequence
        951 bases(100 bases per row)
agagccaccaggtccacttccagcacaacgtagcaatgtccaccgccgctcgtcgacgattaatgcgcgacttccgcaagcttcagaacgacccgccgtc
tggtgtgtcgggcgcccccatggacaacaacatcatgctctggcaggctgtcatcttcgggtaagctcctccttcgtttttaccttttttatttactttt
aatattttctgtaaacgctgcaggcccgatgacactccctgggaaggaggtaccttcaatctgacgcttgaattcagcgaggactacccaaacaaggcgc
cgaccgtcaagttcatcacgaaaatgttccaccccaacagtacgtgcttctcactcttccatttcttcccttatgcctaactagttgttgttttgccgct
taacagtctacaacgacggtcagatctgtctggacatcctgcagaaccagtggtcgccgatctacgacatctcagccatcctcacgtccatccaatcgct
gctgtgcgatcccaacccgaactcgccagccaactcggaggccgcgcgtctcttccaggaaaaccgacgggagtacaaccgccgtgttcgtgagatcgtc
gagcagagctggcaggccatcgcgtaaaaggctcgttcgtttgtctgcgcagctattccgctgctgtggactgtagcaggagtcgggtgtctgctattcg
tgttaatgcattgcctctctttcttttttcctcgctccacgccaagacccagagcaaaacttttctcgagcgcgacctgaacagggcatgaacgtacagg
tctcaaccgatgctaggagcaacatgatcgaagcagtgcttttaacgagggacagagatccacgaatggcagtgaactgattagccagatgcatggtagg
agagatgagaactgaattttaaagagaagaaacgctcttttgatttcttta