Transcript Name :
Phyca_LT1534537973
Orientation:
(-)
Number of Exons:
5
Description :
NF-kappa B inhibitor alpha
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-271
NN-scoreoddsWeighted Score
0.8441.4040.003
*** None ***
TypeScore
nuclear478
GO
*** None ***
*** None ***
*** None ***
Sequence
        1651 bases(100 bases per row)
atgaagcgattgatccagtacttgctcttcatgcgtggacagattccgtggtgcgttttagctatgaaatggttttatttcgtgcaaaataccaacaaaa
cggtacttgcttcagtctctacgacgatctgctgttgctcgtggagaattataagcgtcaacaacaggaacaaaatggagcacccagaaggaaaaagtat
ggcagtgctgagttccagtggttgggaggaataagctgagtttttattaattaggttgacaatgggtggaggcatcaagaaggctgtcaaatgtgtcgag
gcatcggagctgctgttcgctgagcgattggatgccattttctccttgagagtacagagaggtgagtgcagtagttatctgatttagttgactactatga
tgctaactgagctgcagtggcgttggtgtttgggtcatcgatgatgagtccaagagaggttcatgttgtcgattttaacgagacccagaacgtgacaaga
gctgagcctccgaccaccgcttcgccagatacagatcaggaagatatgtcgcttgaggactctcagacactcatttctccgtcaccgccgttgacaaggg
agaaattaaagcttctgtgcgctcagaaactcatgcgtgcagtgttttcaagcgctgtggagcagttctcgaggtgaggatcgctgctgcatgcatacga
cagcttgtcgctaatttgttcgttgttgatttattctagcgcactgtcggctacaaagttgcatgttgctgttctggcggtgcgacagtcaacgcgcatt
cctgggtttcttccgaagcaacagtttaaacttcggctcccaaaggacaaacgtggagcacgaacgcactatattacgataagtgacggctctgactgct
cggaacaagcctcgaattgcacgaacagcccagggaacggaccgtccgaagaaattcacagggtggaagcatcaactgacgtgaatttcgtgtggtacgt
tctggagcaacccatacctggttttaccgaggttatcaacacgctcgacagtctctaagcacgacttgaagacgagcgtacgcatccaaaaatattctcc
agagtgcgctgagatttctgatcctgaggttcattgatgaggacgaaagttggcaaggaaaagttagcacacttgcggattttattctggaaagatgcag
caagtcccgtcaccgacagcctttgcttcactggaagaacggatcgcgcatctgaactggagaaaaatctgcaacgagcgggagattcagggcactcttc
gatacagcaagcagctccaagaccgagacgagttcattcgcgccgctaagagtggcaacaaagccgttcgtgaacggatgcagcaggtgatcaaggacga
gttcaccaagccacttcctgtgaccacccagttctacgaggaactgacggcgttgcagcgtaaagacgagttaaaggctcaggaagtggccgagagacac
atgactcaactgcataacatccaggcgaagttagacgcccgtgaggctcaattgatgcgtaagaaggagttcgagcggaagaaaagggagttattcgcag
ggaattaaggcctaaaatcttaacggaatgtcaagagctcaatgtcgaaga