Transcript Name :
Phyca_LT1534537935
Orientation:
(-)
Number of Exons:
1
Description :
unkown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
64-93
27-40
7-26
41-63
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        279 bases(100 bases per row)
atgctgaagtaccagaagtggctctctgcgttcgtcgtgctgctcgctgcatggctgttgctgctgcggtatgtgaccgaccatgtacaagactcgcatg
tggtgcaagtggtgaaagcgctgcccatgtacgccatcgtgtctttcggcgcttactctttggcggtgattgcgctgtccgtcatggcggtgcaagattt
cccagaggcttccaaggaactggacaggcaagtggtggaagccaaagctgaccttgccaaaaagggattcaagttctag