Transcript Name :
Phyca_LT15344102
Orientation:
(-)
Number of Exons:
2
Description :
heterogeneous nuclear ribonucleoprotein U-like protein 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
SAP domain12.163PS50800
HmmSmart predictionP-Valprediction_id
SAP domain4.1SM00513
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-519
NN-scoreoddsWeighted Score
0.5871.9610.004
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
Cluster Id
2075
Sequence
        1693 bases(100 bases per row)
atggcggaacgggcggaatcggcggacgagcgcgctctgcgtcgcgagttacaagagctggggaagaagcgcgaggcgctaaacaactccagtacgttct
gctctatctcctgctcgtttttgaagagttttaaacgcctcagaccggcgtagctgctcttttaacccatcccttgcgttgcaattttgtatctaattgc
tcttgcttcgttttctgccatctacagaccgtcgaggcagtgcgaaagcgaaaggggatgcagcaggccgacgcagtgttttcgatagacttggaggaga
ggcaacacgaggccgacaggttgttcagctaaaggagaacagcatccgaggcaatgcctcaaggaggccggggaagcgcaataatgaggataacagagag
aacaatgctgtgaagagacagaggctacactcagccgtggccagacctgagggtactcagaatgcagaggggagaactgtcaccgcagctaattctcccg
tagtgaacagtgctcgctctcaggaactgaggcaacgagcagtagctccttatgcacagaaggatggcattgcacgcagccgccgcatgtttggagcgct
gatgggccatctaggcaaggcgaagcggcaaatagagaaggacacggacttgtttaagcgccaggacacgaagcagcatgaagctgaacagagggagaag
aagcagacgaaaaccctggagattcaggcgcgtcatgtggcagagatagcacgactggaagcgctcatttcgcgaacggagctggatcgtagggagcaga
ttgcacgagccaagctggagcatttgcagatgctccggaagagcgagagtcaatccaagttcttggtcaccattacatcacctccaattaactaccttcc
agcaaagcatacaaaagagacaaaggagctcgttgctgcttctctggaggcccatgcagcaaaggtgaagagcagccagcgaacccaagaggacaaactt
cgaaaactagaagccgaatttgagatcaagctggagaagcttcgtgatgagctagaagcagccaagaaggaagacaaagaggacgaacaaacatccagtg
caagacaggatgacgagatggaagatagtgatgaggcagtggaccaacacagcaaaaatgaagaaaatgaggaggagaaactggaaaatgcagacatcat
ctccagtggatcgccaacagtcacctcgatgggggtcgaagctgataacaaggagagtggtccaggaagtgatgcagaagactccagtgatgtcggaaga
agtcaaaaggatggcaatgccacaagtaactcgaagaaggatgtatctccaaatggacccaatgcagatcatggtgacacgacagcttcgtcacccactg
gacgtgagaagcaaaagagcgtagagcagacaccggaggaagcgaagactccacaggactctgcgactcaacctgcaggtgacgatgaggatagtgtaat
gcaggaagaaaacgctgtcgaagaagacgtagccgttgagccaaaggaggacctgagcgtaaatgtcgataagctgaaggtcactgagctccgtgcggaa
ctcaagaagcgcggcctcgacaccaagggcctcaaggctaaactcgtgcagcggcttaagcaggcgatgcatgaaggtgacgaatccaagtga