Transcript Name :
Phyca_LT1534557860
Orientation:
(+)
Number of Exons:
6
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
COMM domain9.753PS51269
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
COMM domainIPR017920
*** None ***
InsideOutsideTMhelix
1-209
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4743
Sequence
        1164 bases(100 bases per row)
atgagcaggagcttcgctgcggacgagcgcgtgctggaggctgtagcacagaccagcgtcctatcagccgagagtgagttgttgaggtgatggctaatgc
atgtgagaaaggatgggcattggatcgttgaccttgtggcaatttgcagactttggtgctgtgtgcaagttggcagtgcggctttttggctcggacaagc
agagcaagcggcgactcacccgcacagcctgtaaggatcgttgatgatgtagtgtgagctgaattgctacgtgaagtattcattgcgttgctgttgctac
agcggcgtcgggatgggaaacggagaaaatggagcaggcagtccttggcatcgcgaaggttctcatggacggcgccaaggtgcgtttgacgtagccaaag
ctaccaatctatagccgacctctcatgcatacgttgttgtaggttgaaatgtcagcacatgctttccgattggtcttgaaggggatggcattaccggagc
aacatgtcgacgttcttgctcaggtatcaagtttctgcttcctttcgctgcggttgcttttgtttaaccagctgtgttgtggcatgcgcagttatacgaa
acgcacgccaaagggatccgagagtgcgtctccagggaaactggcacaagcgtgccgcattatcgcaatttggagtggcgaatcgatctcgaggtaacaa
gtgcgttaaacaataagcctgtgtcacaaatccttacgtcgttgattgcagctcggtactcgtttccaccgtaacaagccgaagcccattgtgactcttc
ggttggacacttccacccaagccaacagtaccgctgtgccgaaggttcaatcgacctgccttcgcgctgactacgacgggctgaagatgatgcagcggca
gctggagacggcattgaaagaggttgattctgtgcactgcagccgcattcagcggtacatgtagcaaccgtactgcaaacagtcacaacagttcaagcgt
tttcaattttctttcttccggtctgctaaatactgctgctttgtcttggtgaaggccgtaacctggtccagttgctgcttggattcgttggaaatgccgt
ccttctgcagcaaaagctcggcaaacttggcctgtttcttctgcctcgctactggatccggctt