Transcript Name :
Phyca_LT1534557875
Orientation:
(+)
Number of Exons:
3
Description :
5'AMPactivated protein kinase subunit beta putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-160
NN-scoreoddsWeighted Score
0.6145.6670.011
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
KO ID
K07199
K07199
K07199
K07199
K07199
K07199
K07199
K07199
*** None ***
Sequence
        1503 bases(100 bases per row)
gaagacgtcgtgcccatggtgtttaaatgggaacacggcggacgcaacgtgttcattacgggtacgttcaacggatgggacaagcagtgccccatgcaca
gatcgggtaacgactttacgtacattgccaacctcacgcgagggaagcacatgtacaagtttgtagtggacgacgactggcggtttgcccccgatcagct
cacgatggcagatgtggaagggaacgttaataactacgtggacgtatcggaatttgcaccgctctcggactttgacggcaagaaactacaggacgacgac
gaggaccccgaaaacccgtactcacggtacatccccgagatcgacgagtacaccaaggagccacctccgctcccgccccacttgcggcacattatcttga
acaaggtaagtcactgttgcaacgtccggaggttatgctggtcctgacgtgcgtgtttttacgtctgtgttgtgtcatgctcgtgcaggcaccgccgaca
gtcgacggccgattgctacctgtgccccagcacgtggcgctcaccatctatactgcacagcaatcaaggacggaatgatggtgcttggcatcacgaatcg
ctacaagcagaagtttgtgaccaccgtttattatagcctcatgcccggcgcaaactagttcctgcttgcgtcttgcaagatctggttagatgagccggtg
ggcgggtagaagacgacgcaaaaagcgggaggaagctcggagcgcagtcgtgaatgatccaagtgttggacgcggcgtggcatgcagtgcgcgtgccttg
ctccacttctgtaggacgtagacagcaatcttttttttggtagggagctgctcaaaaaatggtcgtagcgagcggcagggcatggccaacctaggaacgg
cgaagcctaaagcaatgacaaacgaactcactacatcttcgtcctcccagccctcgccgcaccccgtatgacaaaacacagagactgcgagcagctcaaa
aacaataaaacatattttttgtcttcttcttgcagcggacaaggtcagctcacgctatgtcagagaccgccccgactacttcatagcgttcttgtcaaca
aaaccaaaactgcgtaattcttctcttttccacgcttctcctaccgctggattgagttttcgtctgctgagttttatacgtagatttcagcccacaagaa
gaggaagagcgagccgaaacccagcaggagagcagcaatgaaagccagcaccaactccaccactgcgttcttcttaggagccaccgcgcgcgtgaagaag
agcgacatgaagaccagaccagtcagcaacagcaccacagtcaagaagccatagctctccgggtccacagggctcgtgtacgggatttcctgcacaacaa
cagacaaaagtgagactatatccattgggatacagtagacagcggcaggccacgcaccatttccatcgtggcgaagtgttgagatctgcttggagctctt
gct