Transcript Name :
Phyca_LT1534537910
Orientation:
(+)
Number of Exons:
1
Description :
carbohydrate-binding protein, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6060.72622
InsideOutsideTMhelix
1-521
NN-scoreoddsWeighted Score
0.7165.6710.011
*** None ***
TypeScore
extracellular, including cell wall444
GO
*** None ***
*** None ***
*** None ***
Sequence
        1563 bases(100 bases per row)
atgcatccgcgtttcaagcttgcgtttgctttgactgcatttggtgcagtgttcgcccatgcagaacttcaagacgtcccaagcttcgcagtcccgtcct
ttgattacggttccttgcagactgaggatgtaccaagtcgcatgctcgaagctctggagcgtggaggcatcatcgctctcaagaacatcccaaactatgc
taatgtccgcgagcgcttcttaacgagcgcagtggaatgtgctgtagcttcggaggaaacggaggaagcaacgcgctacctgtcgaccaagaagttccac
gatggcactcgtcgcctcacactacgagctgctgccggtcgagagctactggaaacagatagtgaaactctggatgcaatggcagcccattgtcccggcc
atcgtgagctctacgaggagttcagcggcactttagagcgagcggtggacacttttgcttcagctcttgaccaaacaaagttcacgatgggagacggtga
acgttccatcagtgctcggaaattggtcggagacgctaaacgactcgatcacttccatgcgtacgaagctgctcaagctccagtacagtcgaatgttcaa
gatatcgaacgggacttgtccttagccatgcacgaagatcacggactgttcatcgccatggcagctcctaagttctactctgtcaacaatgggaatgtcc
gtgaacgacgtctcaagtccgacgcctctggtttagtgatcggagctgcggacattgatgaaatcgttcgaccagagttgaaagccgacgaattggtcat
catgatgggaactggagcgtcccgttggctgcaaaccagtcaccacttgccggcggtcatgcacggtatgcgaatgcctgaagaactggtcgaagacgtt
ccgggacagcggaatcttcgcgcttggtttggcaaaatgacgttgcttccttcgtaccagcgtctgctttcgactaatatggactttgacgagttcacaa
accgaacgacgcgccatttacttcaaccgaacacgaacaacctcaaagctattggatgtgcaggtggacggcacttggtggagtcggaggggagctgcac
cttcaagatctgcactttgaagcctggagtggagagaccaccgactgtaggctgtagacaagcttgcaactatggtaccgagttcttcgatgccaaatgt
gccaagaaatgtgactgcacgggcacaacgacacaagcagatgtgtgctggatgttgtgtgtcgctcgactacctgttagcgaatgtgcgttggaagatc
aggagtgttcaggcttgaaaatgatttgcacagcgaacaacacaggcgcgaacactaccacaactgacgcacctgtgccgacagcaacgtcaggagcgac
accactaccgacacctacaccggaaatgccaacgtcaacagagacaccagtaccaaccactgcgactgaagctcctgctgagactccgttgccaacgacg
actccagtccctgcaccgaccttcgacagtgccaacaccagtgaccaccactccatcatctga