Transcript Name :
Phyca_LT153475083
Orientation:
(-)
Number of Exons:
2
Description :
AP-3 complex subunit delta, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-590
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K12396
Cluster Id
4655
Sequence
        1884 bases(100 bases per row)
atgtttgagaaaaacctgcaggatctggtcaagggcatccgctcggccaaaggcgacgtgagtgtgtacatctcccaggccatgcaggagatcaaaacgg
agctgcgtagtaccgacccgtttatcaaggctcaagcagtacggaagctcacatacctgcacatgctgggctacgacatgtgctgggccgctttccacgt
tgtggaggtcatgagctacgaacgattcgcacataagaggatcggatacaatgcagcatgccagagcttcacacagtccactgatgtggtgctgttgtgt
acgaatctcctcaaaaaggagttcggaagcaccagcgagtacgaggtggggctggccatcaacgttctggccaatatcgtcacaacagatttggctcgtg
atcttctgggcgatgttttggctatgatggggtctcctaagccttatgtacgtaagaaagcgactctggtgctgtacaagatgttcctgcgctaccctca
agggcttcgactgtctttcgatcgactcaaggaaaggatggaggagccggacgtcacagtcgtctcttgcgctgtcaatgttatctgtgaattggccaac
aaaaagcccaagaactacttgggtctagcaccgcagttcttcaggctactcaccacgtcctccaacaactggatgctcattaaggtggtcaagttgttgg
ccagcctggtacctgaagagcctcgtttggctcgcaaactgcttgatccactcgcgacggttatccagaatactccagccaagtcactactgtacgaatg
catcagcacagtaaccacggcgcttttgtacaccaagaagagcgacggatcacagccacgcaacgtcgcggcagtcgtcagactctgcaatgaccatcta
cgtcgctacattgaagatccggaccagaatctgcgctacttgggtcttgtgggcctcgggaacctcatgaagtcgcacccgtacgtggttacggagcacc
aggagctgattgtcgagtgtttggctgtggatgacatcaccatccggatgcgagcgctagagctgctgtctggaatggtgaacccggacaacgcagcgcc
aattatccgtgaactcatgcgccaaaccttgagtgctgatggcgtgtaccgtcacgagctcatcacacatattttacacgtttgttcagtcaacaagtat
gccaacattcacgatttcgactggtatattcacgtgctggttcagcttgctcgtgtgccgggtaatactgctgcaacagtcgatgcgtcgttgtcatcgt
tagctccttcgtcgggaagcatgcttggatccagcagtagcagtacgaagatgaaagcgaatgacgacgaaccagcgaaacgttcccatggcgtggaagt
agcgcgtcagctcgtggacattgctgttcgtgtgaagagtgtgcggagtgttatggtggacaatatgatcgaactactgatggagaaagaagcgctcagt
ggaccaggagctgggactctgcaagaagtgtactatgcggcagcttggatcacgggagaatacgtcatggagttcctggacgatgtggacgatgacgatg
aggacgaagacgaggaagaagaacgggaaactgaggaggagaagctacagcgactagaggatctcgccgacgaaatgctgaagcctcgcaccacaacgct
tcctggccacgtccagactgttttcattcaggctcttttgaagattctcacggccatgtctgagcgtgcagacgacgcgactgtggagcgcattgcaacg
gttatcatggaacgtctacctgccttcgttcagagcgagtatatcgaggtgcaggaacgcgctgtatgtctacagcagctctta