Transcript Name :
Phyca_LT1534537913
Orientation:
(-)
Number of Exons:
2
Description :
microtubule -associated protein EB1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EB1, C-terminal13.569PS51230
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-259
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
microtubule bindingGO:0008017IEA
*** None ***
Cluster Id
2167
Sequence
        1079 bases(100 bases per row)
ccaaaaagcacgacacctcatacgttaatatcatggcggctgcagaccagagcatgagcctcatggacggcacgtacttcgtcggtcgtaaggagatcct
ggactggatcaacggcctgtgcgccatcaacctggctaaagtggagcagacgtgcacgggcgctgtggcctgccagatcttggacgcgatgtaccctggc
aaagtgcagatgagcaaggtggactggtccgccaataaggactacgagtacatccagaactacaaggtgctgcagaaagccttcatgcaacttaagatcg
acaagcacgtggaggtggaccgtcttgtgcggggcaaataccaggacaatctcgagttcatgcagtggttcaaggctttttacgagcgcaacgcctctgg
tcaaccttatgaccccttagcacagcgtgagaagggcaaaggaggtgcacagtacacacagaagttcggtggagctactgcagccccagcagctccttca
cgtcggaaagtggccactacgacagcctccagagtcggtagaacgcctcctggagctccctcgacggtgggagctgctcgaacgacgcggacaccaacga
ccgcttctcgtcgtccggtgggaaatgctggagcagtgccagcagcttccgaagtggacacggaagctgctgtggctgcggcaacagctccgttggagaa
agagctggaggaactcacggctagtaacgagacgctgacaaatgagagcggagagttgagagcgatggtaaggagatgaacttgttaaatggaggagaga
gactgactggtgtgtttaataggtggagagcttggagaaggagcgtgacttttacttcaacaagcttcgtgaggtggagattatgttgcagtccgcagag
gatagcgaaacgaacccgttggcacaggcgatcttcaaggtgctgtacgccacggaggaggaaggaactgaggacgaacaggtcgctggagagccacagg
acgagccgatgtagatcatctcgggaagatacggtactgtgagatgaacctgaaaggggggagagaaggaaacatcaag