Transcript Name :
Phyca_LT1534531455
Orientation:
(-)
Number of Exons:
3
Description :
transcription initiation factor IIB putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Transcription factor TFIIB5.6PR00685
Transcription factor TFIIB5.6PR00685
Transcription factor TFIIB5.6PR00685
Transcription factor TFIIB5.6PR00685
Transcription factor TFIIB5.6PR00685
*** None ***
HmmSmart predictionP-Valprediction_id
Cyclin-like3.5SM00385
Cyclin-like0.0061SM00385
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclin-likeIPR013763
*** None ***
InsideOutsideTMhelix
1-195
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
regulation of transcription, DNA-templatedGO:0006355IEA
DNA-templated transcription, initiationGO:0006352IEA
KO ID
K03124
K03124
K03124
Cluster Id
2883
Sequence
        1284 bases(100 bases per row)
ccaggagcgaagacacagccagatcaaatgggaggcgagtgcgtaccggatcattgccgcgagtgcggaagcaaggacgtcgtgacggacttcagtgcgg
gtgacgtcgtgtgccgcggctgcggcatgatcctcggtgagcgcattatagatgattcccccgaatggcgaaactttgctaatgatgatcggggtggtga
ccccgctgccaaatccagggtcggcgacgtcgcagacgcacgtcttgatagtgtctcattgtccacgtatctggttgacacgaagaagggcggcgggggc
gatggcgagccggggcgcaagcacaagcggcctaacatttcgtccgacagcgccaaggtgaagaggatgcagcgcaatatggctcgcattcaggaagtcg
cagactatctatcgctacctaagaagatcgtggaaattgcactggacgtgtacgcggaggcggagaagcagggggtgaatatgcgagggcctgaacgaga
aagtatggctgttgcagtgctatttatcgcgtgcaggaaggcagggaatgcccgatccctcaaggaatttgaagaggcctcagggatccccaagcggcgt
attggcaagtcctttatgagtttgcaacgccgtttggatctagaggtgaaacaggccacgacggaggagtatgtacagcgcttctgctcgagactgggac
tgcccaacaagacacagatgattgcgcacacggtggcgaagaaagcagatagcttggaattgtcgaatggacagcctccggttgcagtggcagcgtcggt
gatctatttggtggcagcatacacgaacgcaaagcgttcgatccaggagattagcgacgtgacaatgattgccgagaagagcatgaagagagtgtgcaag
gagttgaacaagagccgtgtggtgcttttcgaaggcgtggtgatgacttagacggctgccacaagagaaccaagggcacaggacctcgtaagtaaacagg
aaggagggccaccgagcactcaggttcgtatatatttataggaggccacacacctcctatttgcatggtaagacccaatcaagaaatctcttgaaagtag
ctctctgtctgctagttgctgctgacttgcgtgttgacctgactgacgtttgatgctttgcttgttccttgtttccaggccaaatagagacctagagata
gacaatagaagagccggacgcagcctccgcgccgatggctgtgacgttcttgtacactacgtaatgttattgcttgacttcgga