Transcript Name :
Phyca_LT1534537937
Orientation:
(-)
Number of Exons:
1
Description :
unnamed protein product putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S9A, prolyl oligopeptidase3.8PR00862
Peptidase S9A, prolyl oligopeptidase3.8PR00862
Peptidase S9A, prolyl oligopeptidase3.8PR00862
Peptidase S9A, prolyl oligopeptidase3.8PR00862
Peptidase S9A, prolyl oligopeptidase3.8PR00862
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-749
NN-scoreoddsWeighted Score
0.5481.2390.002
*** None ***
TypeScore
nuclear435
GO
Biological ProcessGO IDPrediction Method
serine-type endopeptidase activityGO:0004252IEA
proteolysisGO:0006508IEA
*** None ***
Cluster Id
2087
Sequence
        2375 bases(100 bases per row)
tgaagaaggcgatgaagactgcgggcttgttggccgagaagctcacgtaccctgctgtgcgtcgtggggacctagtggagacgctacatggtgtgcaggt
ggcagatccgtatcgctggctggaggacccggactcccccgaaacaatcgacttcgtgacgaagcagaacgaggtaactcagcgcgcacttagccaaatg
ccgtgtgtgtccgaaacgaagactcgtatgacggaactgttcaactacgagaagttctcggcccctcggaagcatggaggcaagtacgtgttctccaaga
atgatgggctgcagaaccagagcgtgctgtacatccaggacgagctgcacggagagccacgtgtgctgctggacccgaatctcctggccgctgatggcac
ggctgcgctctctagtcgagccttctcggaggccaagcttcaggatggaaaactcttctttgcccacggtatttctcgtggcggatcggactggcagacc
attaaagtgatggctgtacacgacaataacaagatcttggacgatacagtggagtgggtcaagttctccagcatctcctggacacatgatgacaagggct
tcttttactctcggtaccctcccccggagaagatgaagggggacaagcacgatgatgaagaagggccaaagagaggaactgagacggactccaatatgaa
ccaccaactctggtaccacaagttgcataccccgcagtctgaggataagctggtgtatgcttacccaactgaaccaacattcaatgtcggtgcggaggtc
tcagacgatggtaagaagctgctcctgtacgtgcaagatggatgcaagaatgccaacatgatccatgtcgcggacttggccggctttgaaaactttttaa
agggaccaagcgactcaacgatctcggtgacgaagctcgtggacaacatggacgcagcattctcgtacattctgaacgacggagactactactacttcaa
gactaacgctgatgctcctcgtgaacgtgtcgtgcgtactaaactgggggatacgccggtgtgggaggaggtgattcctgagcagcccgatgctatcgtg
attgaaggtgtgcaccctgtggcgccgaatctgctggtcgtgcagctccttaaggacgtgcacaatgagctgcacgtgtacaatctcgatggtgtgttcc
agtatgaaattccgctacccagcgtgggcactgtgggagttgccagcaaacgcaccgagtctgagctattctaccacttcatctcgttcctgtacccagg
gtcgatcttccgcattgatttatccagtaattgtgcaacccctggagcggcgcctgatgctgagcttttctgtgaaaccaaggtgaaggggttcgatcca
agccaatttgaggcggagcaagtattctatccttccaaggacggcacgaagattcccatgttccttgtgaaacgtaagaacatcccgaagaacggcgaac
ttccagtgtatttgtacggctacggcggattcaacatctcgctcacccctgcttttagcgtgtcgcgcctcgtgttcgtccagcactttaacggtatgct
ggcgttgcctaacctgcgtggtggaggtgagtacggtgagcagtggcatcaggatggtatgttgcacaagaaacagaatgtgttcgacgacttccacggc
gctgctgagtacttaatcaaggaaggctacacgaacccggagaagattgccattcatggcggatcaaacggtggcttactggtggcggctgctagtaacc
agcgtcctgatctctatcgctgcgttgtgggtgctgtgggcgtcatggatatgcttcgcttccataagttcaccattggtcacgcgtggcgcacagacta
cggcgacccagatattgccgaggacttccactacatccgtcgctactcgcctgtgcataacgtgccgcatgctgatagcccaattatgcagaagctcgca
gagcgtggtggattcccgtcggtgctcctgactaccggagaccatgacgaccgcgttgttcctctgcactcgtacaagctcattgctgagctacagtatc
agcttggaaactccgagacgcagacgaaccctttgctaatccgtattgacacgaagtctggccacggcgctggcaaacccaccaccaagatcatcgagga
gacgtctgaggtgtttgccttcatcgcgtggaaccttaatgctcctttcattgcgtaagttgtgcgccagtgctttcaatactcgcaagctcaaggaagc
aagagcaacaagctacggttcaataatacacctgtattcgtctgagcatccactacatacatgtcgaacgtcgat