Transcript Name :
Phyca_LT1534531464
Orientation:
(-)
Number of Exons:
5
Description :
PREDICTED: DNA-binding protein SMUBP-2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain9.849PS50102
Zinc finger, CCCH-type13.948PS50103
Zinc finger, CCCH-type7.808PS50103
Single-stranded nucleic acid binding R3H13.478PS51061
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain5.5SM00360
Zinc finger, CCCH-type0.0018SM00356
Zinc finger, CCCH-type98SM00356
Single-stranded nucleic acid binding R3H0.0056SM00393
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-607
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        3067 bases(100 bases per row)
gcagttgatcaagatggacaccgggacgattgtgctgtcgggcatcggcaccgagctgtccgatggcatgctcatgaatatgtaccgcacttacgggccg
attcttcgcgtgtctcacaatggcacaaactctgcgtacgttgcatgagcctaatttgtaaattggaattcatctaatccagtgtcattttaatgcagtc
acgtgatttttgagcagagattgcacgcacagaaggcagcagaggctacaaatggtgctgtggtgtttggcaagagactgaaagtagcagtacagcgaag
cttcaagtcgacggagccgtgtcgcggtttcgctgctgggatctgccgctatggagatctgtgcaagtactaccacgttaccgacgatgcagcatttgca
ccaccagtgcctcctgctgtgaaagctcagcgtgaaccaaagcagaaaaagacaccgaagcctaagcctgctcctcttcctgtttctgctgctgcgacgg
ctgaagctgaaggagttccagccaaacaactttgtcgtcacttcacgcgcggcttctgctcacaaggctccgcgtgtacgtttgcccatgttctgggtgt
ttccaaagacgctgcgcctgcacctacgggaaaagtggcgcaattgtgccagtttgacctcagtggagtgtgtactcgtggagatgcctgtagatttatt
caccagcccaaggaaaacgtattagagaaggcgtctgaagtggaaaacgtgagtgaaagtgagaatgaggctgacacagaacagagcgaggcgacgcgca
cgtgtgttgaatgcgagaagcctggagttgctgtttggaaatgtgtcaagtgtgacaactcgatctactgtgacgactgtaactcagctgttcatcgtgc
ccgtgtgatggcgaaacacaagcgctcaaagcttcctccagttcccacgctgcctcgctgtggcgagtgtgagtctaagactgcgattgtacggtgcgaa
cagtgcgaggttccgttctgtactgcgtgtgattcaagcgtgcacaaatttaagagtttgcggaaacacacgagagtaaaactgtcaggcaaggtggaga
agacaaaggtgaagactaaagaggtcaaatctgaactcaaggtggaaaagaaggagaagacccagccaaaagtacctacaccgcaagtaaaggctcgaga
acccgtgtcttacgtcgagagtgtgccgcagctcgagttatccagtgattcagactcatcagaggacgaggagatgcctgaagtctcgccagctcagcca
aacacagctcaggcctcttccttaccagtggacaacgatgaaccgatgacgaacgcgtcagaaacggattctgaggaagactttgacgatgtaaaaccct
cgtcgtcaacaccagtgacccccacgcctgctcctgctaagcaagaagaagcttcagagtcatcagattccgagtcccaagacgactccgatgaccaacc
tatcattaaggcagagtcacttcccgtgtctgtcccgaagatggagttgtcctccgattccgacagttcggacgatgaaccttcagagccgaccccggcg
tcttccgaaactgaaagtgaatccgaagctgaggctcctaaaccctctacgaagtccacaccgacagttcacaagcctgcattggcagaactatcgtctg
aatctgaaagcgactccgatgacaagcctgttgtgaagcagacaaagaagattgttcgcaagccagcacctaagccagtctcagagtcatcgtccgagtc
ttcttcggaagaatctgaagatgaagctcctgttccgaagaagaaggtagcttcggactcaagctcagactcttcggaggatgaagctcctccagtaaaa
cctgttgtcaagccaacacctcgagctgctccaaagcctcgtaaccaaaaggctggaggcatctcggagggcagttcccacactttagtgaagaagatcg
aggctttcagcgagtcaagtgaagcggacgaaatgcatcttgatgcgaacctgaacggcttcgagcgactgctagcacatgactgcgctgagcgtcttgg
acttgcccacgagagcatgggctctggcctcgagcgccatatcattatctcgcgtcttgggaagcgtacggctgcagatgctggtgcagaccgcaaggct
aagaagagcaagcgccgccgctaagttctggccaaagaaggttaatgagacaaagacttagctagcctatcgacaccgaacagctataatagattcctct
tcttctccgtgttcatctctcgcttcaaaagcttcaacgtacgtacgttcgtctgtatctcacacttgcaaagcccacgagagcagctctaggcgagcac
caaatagctccggagtgtccaatttcttgctctaaccttttcccttcgtccacgtgtaaaactgtccgtccgaaagctcgacaggatcccatcgagcgct
gtaattgcgacggcagtcttacttgcgggcagcccttctgtcagcacgggtagcagcgtggaaacccgagcggatagcagccacagaccgcgacgagccg
cagtcctggcagtgcacgaagtacaagcggctgaccgagtcacgcgtgagcgtggtgttcggcgagcggcacatctggcacgagacgtactcggtgatgt
acttgcgtagcagcgactcaatgtacttgggcacatagcgaccacggatgacgaggcgctggttgccatcgatggatccttccgtacccagttcggctag
cgtgaactgcagcacgtgttcgggcgaacggtgcatcatctggcagatctcctggaagttcacccacagcgtcttcttggtacccacacgcatgagctgc
ggcggcttcatggtgtgacgcttgcggtccgtaagctccgggttgttctcgtgcagcttagccatgatacgggccaaaagctcgtccttgtacgagtaag
tagcggggtcctgcaccagcaccgagttggcatctggtgcagcatcagccacggcatcttccgactt