Transcript Name :
Phyca_LT1534537893
Orientation:
(+)
Number of Exons:
3
Description :
Glutamine cyclotransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-302
NN-scoreoddsWeighted Score
0.6732.5890.005
*** None ***
TypeScore
mitochondrial739
GO
*** None ***
*** None ***
Cluster Id
4357
Sequence
        1038 bases(100 bases per row)
atggctcgtaactcggtctccagacgtccaagacgccgtgatcgatgggctgcatcggcggaagcgaataggatcgcagcagcagcgcaagaaccaagag
aaaaggaagtcggaatgctgccacgtttccttgtgcgcttgggcgtagctgtgttccttgtgggggttgtggtcttgttgacgtacttgacgcaggagga
gccgcccacgtctactcctaagcgaccgctgaactctcatgaagaagcgagggttgaagcaagagcctcgcgccgaactgctgctcgccctacggtccaa
atgttgggcaagtatccccacgacgagaaagcatttacacaaggcttcacagttgttagtcgcggccacgacaagattttcatcgagtctacgggcttgt
atggggagtcgtccttgcgccacgtggatattgaaacgggaaaggtgttgaagcagtacgatctgcctaaagagctctttggggagggcgtaacgcttgg
tccggacaacgagctggtaatgttgacttggaagagtaaaactggccttgtattcgacctggagggagacaagaacagcaattcaattgggtttgcattg
aaacgtgagtttaactacgacactgttacgggtgaaggttggggcatcactttcgacggcgaagactacttggtttcggacggttcgtctaccatcatgt
tctgggactcaaagacgatgaaggaggtggggcatatcgacgtgtcgatgtttgatgggtcgcagaagatctcccagatcaatgagcttgagttcgtcaa
gggatttatctacgccaacgtgtggtaccagccgtacatcctcaagatcgatccgcagactggtgctgtagtcaccatgttcgatctgtcaaagctcatc
gcggatgctggtgttgacgtaacttctggcgctgtgctcaacgggattgcctacgacgaagcggacgacgcgttctacgtcacgggcaagctctggaagg
ctgtctacaaggtccgtctcatagatcctgtgcagtag