Transcript Name :
Phyca_LT1534524849
Orientation:
(-)
Number of Exons:
2
Description :
tubulin-specific chaperone C, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
CAP Gly-rich domain14.782PS50245
C-CAP/cofactor C-like domain25.666PS51329
HmmSmart predictionP-Valprediction_id
CAP Gly-rich domain3.9SM01052
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
CAP Gly-rich domainIPR000938
C-CAP/cofactor C-like domainIPR017901
*** None ***
InsideOutsideTMhelix
1-448
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1913 bases(100 bases per row)
atggccgtgagccgggtaaccaggctgcgcagcagggtagccctgctgaggtggatactgctgaggggggtatccctgctgtggcgggtatccttgctgc
ggcgggtatccctgctggggaggatatccctgctgtggaggatatccctgttgcggaggatatccctgttgcggaggatatccttgctgtggcgggtatc
cttgctgcgggggtaaccctgctgctgtgggtaaccatggggtggctggcctcctccgggatacatcttgacttggactgggggctctgacagaacttct
gtgctgtcgttcgaccaagaggcgatgaagaatgggatcgtaccgtcgggcaagcaagttgtacctacgtcaaaaatactcctgattggctgattactag
taggtctgttattcgtctaaaatgaaagataatttcaccaatgcaggacgtaattacgacacttggctacactttttcttctggtcgaatatggagacac
cacaggtcgggatgcgttgtgagctgttgtcgtcagggcccagtggcagcctacgcgctagtattaaacgctacggagagatcgcatacattgggatgat
cgacgggctaccgggtgatggctggttgggcgtgaggttggataaaccattgggaaaaggcgacggatcgttccagggcaagagatattttgactgtaaa
cctctgcacggcgcccttgtgcggccggagaaagtcaatatcaaaggagatttccctatacttgcgacgcacgaggagagcttggcgcacgcgctggagg
agcgtcgcaaggagaaacaggggaggaatgcggtggttggcagtgcagaagacccctccaaggttcatcgggaactgacgactgatgagctggccacaaa
gttctgggaggcatttacgcagcaagaagagcacgtacacaagcaggtgggattattctgtgagcagaagaagcagccattaccttgtgagccggacaag
gaggttaaactggacgcactggtgctcgaggtgaacgccatgcgagattcagcagccacagcggcgtcactgtacttgacgccgtatgatacacgccaca
cgcagctgattctgtccaagttgatggagttaattgatacgactcgcgcggcgtttgcccccaggaagaagttcgcattccgagctcatgctgcgaggaa
agccaaggccaagatggagaagcaggaccaacccgaacaggccgctacagactatcaacaggtcttatctgtgccacgggcgttggatttggatgaactg
gtgcacgccaacaagcaggacgaagtgatcatcatcgatagcagcagtttcgctgacgcagacgatagcaagcgccgcgacctgaatttctcgcacctca
ccaactgcattgtgctggtgtgtgtggagacttcagccatccgcggggatgcccttaaaaactgcgtcttctacaccggagcgatctttggcagcgtgtg
gctggagaactgcaacggctgtgagtttttcgtcgcgtgtcgccagctgcgtgttcacttgagctcggcgacaactttccatctccgcattccaagccat
cccattattgaagactgccagcagatgcagttcgggccgtatcgcttgcgatttgatggtgtcaaggggcagcttgaacgtctgggggtatccaaggact
ctggactgtgggctaaggtgaacgactttaagtggcataaagcgcaacagtctccgaactggagcctccgtgatccaaaacgccaactgccgacgatccc
tgctgagttggataagctcgtttcgtatgactaaagctaaggcgacggaggtgatagctaccggtagcttatttaacgatccgaagagaaagtatataaa
cgcatgcagctgg