Transcript Name :
Phyca_LT1534502579
Orientation:
(-)
Number of Exons:
1
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain36.669PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2.2SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-602
NN-scoreoddsWeighted Score
0.6492.2390.004
*** None ***
TypeScore
nuclear609
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2542 bases(100 bases per row)
tccttcccttcttcgctgccatcatggcactcatgagcaagcatgcaggcaccgctcgcttcgtgtacagttccgaaacagtgttttactgtgtgccaca
gtctgcttgctggtgtcaccagcggcgaaaccgccggacgcccggcgcaatattgcacaatggcgacggatcgactcgaagaccgcgtccgaataagact
tcaatgctgcaataaagccgcaaacaggcgtcgcagcgctggcctgcctgctctgcgaccagaacgccgcggtcattcgtatactgccaagagctccctg
taacgcctacactagtgatgggttcgccagcagaattgaggtgaccgaccggttcttgatttcgctccggcatttcaccaaaagaaagcttgaagccagc
tgcgagggtgttcggtcaaaagtatagtgaaaccaagtcaccgttcacgctcgtcagcgccagcaggcaactggatgccgaatattcatggcctgggaca
acgcgaggagcaggcacctgtgcagatctgtggctctggactctcacttccagtatgcgaccccccaccgttgaagaagaagcgtgtcgcgaaaagaata
acccgttttagcgacggcaacagtcccagtttagcagctacaacatggagccgtccgcccgctcctcacggccgcctcgccgagcgcaacgtcttctacc
cgcacttacaccggcgccacccagctccagctcgaccaccgcccagcagaagttcgaggagcccacagacagccgagccgcagcgccgccaggcaaaaag
ccgtcttcgatcgcgcatatcttcttcaacaggcgaccactggacttgatccgccgcacaaccagttcattgctggccacaggcagctccgcacaaccta
caagtgtcgtagcgacgccaccggctgaagagcgcaagttctggcagcctcatcgtcctgtgggcgataaaagcggccgacgaagactacagcatttgca
gcacaaggagaagagcaaggatgagcacaaacaacatccgcagaggagacttcgtcttagtggcgacgttgaagaagcagaggctgagcggaggaagaga
cacgagcatgagcctcgagcaaacaggttcgagtcagctccacagatcagacaaagaccctgtccacttaccggcaagcagtttgtgctggatacagaga
aagcagcggatctcacggcacttgaacgcgtggagattttgcagtacgacgagatccgcttcgtttcatctctggcggtcaaacgcaagcgccgcaatgg
caaaatccagaacgacttgcctgttcacggtgaggaagcggtcaccgcagtcgttgaggaacacgttgaggttcctctgcagctgcacaacgacggctac
gatgacgagcacggagattacttggttttgatgggggatcacttggctttccgatacgaagtactgagtccattgggtcagggttcgttcggacaggttg
tctgctgtatggaccaccgcagtcgcaaacaagttgctgtcaagatcattcgcaaccgaaggaagtatcgcgatcaagcactctcggaagtgcagctctt
gactcaactccagcgtgcagccgctgcttgtgacgagaatcctcacgtcgtacgcatggaggaatacttccagttccgtgaccacgtgtgcattgctttt
caagtcctcggcacgaacttgtacgacttcctcaagctgcggtacttccatgggttgcctatgagcagcgtccgcacaattggcaagcagttggctcagt
ccctgacgtttttgcagcagcaacaggtcgttcactgcgatcttaaacctgagaatgtgctgctggacgcatcggctttggaaggagacttgcgcaccac
gggcctcgtggagaatgttactttgatcgacttcggcagcagttgtcttgaaggtgcccccatgttcacctacattcagagtcgcttctaccgcagccct
gaagtgctgcttggccatacctactcaggtgcgatcgacatgtggagttttgcttgtatcctggtcgaactgcacacggggcatcccatttttgccggtg
agaacgagatggagcagtttgcttgtatcatggaggtgctcggggtcccgccggtcgaattcgttcgcaaaagtaagcgacgtctgaatttcttcgatga
actagccaaccctgcagatattcaagcgatggactacgtccccaagccgtttgttaattcacgcggtcgccgacgcactccgggctcccgtagccttgtc
agtgtagtgaagtccgatgatccggaatttttggcatttttgacaaagtgctttgtgtgggaccccagccaacgtcttagtcccgatgaagcgctgcagg
aaccttggatacttcaccacgccgtcaatcctgtagaatatgagctctaagtaagtgaagtaacccgtacaacaatgaagaagcgaagcatccgacactt
gaccacgttttaacttgctacacgactggaattggaactccc