Transcript Name :
Phyca_LT1534524844
Orientation:
(-)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
CRAL-TRIO domain18.014PS50191
HmmSmart predictionP-Valprediction_id
CRAL-TRIO domain1.2SM00516
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
CRAL-TRIO domainIPR001251
*** None ***
InsideOutsideTMhelix
1-293
NN-scoreoddsWeighted Score
0.6852.250.005
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        1081 bases(100 bases per row)
atgtcactgcacgaaaacgaagaggcccagcccttgtcagccgaggatcaaccgttctacgatgccgtcaaggctgaattcggtgatctttgcactgacg
acctcgcgatccgcgttgctcgcgcgtatcgcagtgtcaagaagaatcgacaggaatttacgatctccgagaccaagaagatcctggacgctcgtgctgc
tcacgatgtggacaatgtcctcaagcacgaactgcccatgtccaagatgtacaacgagtactggccgacgtatatttacggcgaggacaaggatggtcac
gttgtgacagtggatcgactgagcgatatcaacccggacggtttgtttaagacattcccgaatgtcaacgatatcctcccgcaccggtggcagtacatgg
agcgcattcaatgggagaaagcggcgatctcgaagcgacgtggccatcgcgtgtacaaacacgtgtgtatcgtggacttgaagggactgagcatgaagct
tctgtcgccaacggtgttgagccacctcaaggtccgtcttgaatgctgcacttgttgcctttgtatcgctgacttttgttcttttctagccgatctttga
tgtagggcagctctactaccccgagacattgcactgcctgtacgttgtgaacgccccgttcatcttctatagtgcgtggaaagtcgtttcggccattatc
cagccagagacgcgtgaaaagatccaagtgtttgtacgtggaagcccatttggaattgtagagaatgactgacctttgcctgttgctaagcagaaggaca
tgaaagcattcttggaggtggcacagaaccacggcatccctttgtcttcgcttccgtcctatatgggcggatcgcaccctggacgagtcttaaacagtac
tttcacagcttccgaaccggatacgccattccccgtaccgatagtgacaagtgacaagacgaatcctacggaaactgctacggaagttgaagcctaatta
accagcaggagacaggaagcattgatatcaggtatactaatgtaaacgattcttcattcaatggtgacgttcgcgttcatg