Transcript Name :
Phyca_LT153496238
Orientation:
(+)
Number of Exons:
2
Description :
AlNc14C71G4898
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-104
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1344
Sequence
        352 bases(100 bases per row)
atggtgaagaaagtgaagaggaagagatactggtggtgctggagctctgcgacttcaagaaccacccattgttcgacgactacagctctgcaacacttga
agtatgtggattacggtggtagagtgtctagaaaatgctgctaacgttggtatggttcaatagggaattgacacagcgaagccaatgctgaaaatcggag
aatacgaactgcacggccaactggaggaaactgttggtacgagctatttctacgacacggacacgtcaaaatcgccagacaagacgtaccaattcgctgg
ccaaactgttaagaagatcaagtttactattgctccgccagaagacccgtag