Transcript Name :
Phyca_LT1534524851
Orientation:
(+)
Number of Exons:
2
Description :
Transmembrane protein 5, partial
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3590.63929
InsideOutsideTMhelix
36-125
1-12
146-602
13-35
126-145
NN-scoreoddsWeighted Score
0.8195.0330.01
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
Cluster Id
741
Sequence
        1983 bases(100 bases per row)
atgacgaatgccctgcacatgtacccgtccgtagctctgctggtctgggtctgggctacaggtgtgatcctccaagttgttgcaatcttgggctggtgga
catatcgccacgaacgagcagtcagagcgagaaacaagcggcactacagtcctctagaccaagatgactcgaccgattgtgcatcaactgccagagaccg
cagaacgtcggacgatgtaccggagctgagcaccagacgccactccacagcctcagtagaaagtgccaaaacagatgaggaggcagcaagacccaagcca
gcgcgtacaggagcagaagatgatgaggacgagagcgacatccacgtcttcaagtggcaacaacttgcacgtcgctcggccattgccacactgttaatgg
cattatctagcgttatcactactacaattgtactcaagctccgtactggttcctatatggaacaaccttatgaatggtattcgctcgagaatactgggaa
aaggttgttccaggacacgcacaaacttcccgtggatattctggacacgtgtaagtttcgagacgccatggcaaactacactgagttccgaacgttggat
ccgatcgttaaacgatataaaaactcggagatggggaagacggtggtgtacgtggtgccattcgactacgaccacgtgctggaactgaattcggatcaaa
tgatccctattgtggagcctttgcccacgtcctggacgtcatcaagttcttccagtgataatgacaaagatactgttgcaattgtaaccacgggctttgt
caaagcgcgtcctgtagacgagatcacactgttcccgtacttatggcacgaccttctcggcccttacttcgatcctcgagtggagactccagtcggtgac
ccgtggacacgcagagtggacgaactaaatctcgagttccgtatgatccataacgcacacgagttgcgtaaccttccagccaagagcaatttgctagtgg
cagcacagtcactggattgtattcaccggttctttgaggacaaagctcttccgcttgagccccgtgtcggattcctaactctgtcgaaggaaaactgcaa
caatcccaaccctgagcgcttcttggacaatgcagccatcaagttcggactgatgccgtacggcgactgcgctctagtggacggcaaacgctttgtatcg
ctgccactcggacccagctttgaacatggtttcccgctgaacgcgcatcatctcaaccctccgctgcctcttgctactggaattggacgcaagttcctct
tgaatctcatggtgagctggacaattgagaagcctacgcgtgtgcaggccatgatagctgcactggaagtctgtggagaccttgaacgctccactcgagc
caactcccggcgctgtgtcgttgaacacaatgacatgttgttcaaggctctgcaagcagtggacaagcgactgggaactgcttggcgctggtatctttcg
accgctcctgccgcctacgtatctacgctacagcagtcggtatttacgatctgcccgcttggaaagaacccggagcagtatcggatctgggaggccttat
cgtccggatcgatccctattgtggaggagctaccggctcaatgtcagccacctggagtgtttttccacccagcatacccggattcctggcgttgtgttcc
tgaagatgtccatggcgttcttcatcgtttggatgctcctgttcttttcgtaagcgattggaaacgagatctcccacgcctgatgaacaaatacttcacg
aaaaatgatgagtcaaattctgaaaacggaaattcggagtggggagcatggacgccgacagaggaattgttagctttacaagcacgaactcgatcgtggt
acgtgggtttaagccaccacttgcagtcagacctcattgacaaggtcatgacgcattttgcagccccacaagtgacaaaataa