Transcript Name :
Phyca_LT153497146
Orientation:
(-)
Number of Exons:
1
Description :
secreted RxLR effector peptide protein, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5290.64638
InsideOutsideTMhelix
1-20
67-167
215-398
41-43
191-194
21-40
44-66
168-190
195-214
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1194 bases(100 bases per row)
atggagtttgtggagtgctactgggcgctgaacgccgggttaccgttgctgtggcgggctgtgtgcgtccactggactgggctgctgtgggcccttgccg
gagccctcgcttggatgatcaccaagccgatgtggggtgtgctgggacggttgtgttggacggtcttctgcttcgggtacaagtgggcggacatcgtcaa
ggcgagcatccgccgctaccgtcgcttcgttagtggtccgtccgtgaaggaccgtccttcagctgagcgacgctggaagatgtacgaggcgctgtgggtg
acgccgatggtggtattggaggccaagaaggagcacgaggacggtctcgggcggttgttgcacaagtggctggaggcgttccacgcctggtggtgcgtgt
ttctaccggacgctctggagctgggcttccgttctacggtgaagtactgggttggctcgaaggcggagtgcagaaggacggttgaccgtgcttgttgtgt
cggtcgaggcttctggtcgttcgtgtctctgctgttgtatgctgtgttctataccgtggtctacgtttacgagttcgtggagtgggcgtactggggagtc
actggcgttggtatcctggtcgccgctgctaattacttgactgctactggaagtctcaccgcagaggacggtgtagtgctggatgaaggaacggttgagg
cgactggtacggtagtgctcatcggggctgccagtagactattgcgttggtatgagacgtcctctggaggacggtcgccgatggaaatggctggggaccg
ctatgttcgatggatgaaggacctggaagaacaagaacaggctgaacggctcagtgaagcgttctggcgcatggacggctacgtcggaccgagaccaaga
gtgccgacgctcagtgcgttgcatgccgagcgctgtgccaaccgtgaaaggctccgagagctcgagcgcgaaagagctgctcgacgagggcgtcgagttt
cagtcggggaggatgtcacgagtgaaaataatggacaccgtcttgggtacggttacgaccgtaccgttcccgacaaccgttctaccagttatcaagttag
agaggatcagctgtacgaagacgcgttggacaacccaacagtcgctcactcgggaagtcgcgccaaggaccgccgtcatggagggcgccgctga