Transcript Name :
Phyca_LT1534502550
Orientation:
(+)
Number of Exons:
1
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtype200SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype0.023SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype13SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype14SM00368
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtypeIPR003590
*** None ***
InsideOutsideTMhelix
1-366
NN-scoreoddsWeighted Score
0.651.7520.004
*** None ***
TypeScore
mitochondrial783
GO
*** None ***
*** None ***
*** None ***
Sequence
        1225 bases(100 bases per row)
cgtgtgcaaggcctcgtgacccactacaagcgcaaacggtgtgctacggagcccagtgagaccatcatggcggctatccgagcctcagctgccaagcgcc
atcgaccccggttgactatcactgaagaagagatccgcaattgcagcgtcggcgctagagggtgcgtgctcaatagcaatttggacctgttgcaccaggt
ttgcagctttctggacggcaaggacgtgctccgctgccgtgccgtaaacaagttcctgtacatccacgcgccgaccttcgtgaggtctctgcatatcgac
gcggcttcagcttcggcttccgttgcagagactcggaaccgtggagacggcgccgccagtgggctctgtacattgctgcatgaatgcaagaacctaacga
gtctcacgatctcgaaccagacgaaccaaacgcacctcaaggccggtgtagtgttccccagagccttgacggcttctacatacatggcttccctcgcgac
ggcttcgtacggacatcaactggttcgtgaagtgtccaacgcattggaagctggagcatgtccacaactggagagactggagcttctcgctccatttgat
tttgcaagtgagagcgatgcggttttcacggtactacaagcactaacagagtcgaagggccggaaaccgctgcagcatttggtactggacgcgactttcc
tcggtgatcgtggcgttgaaaatctcgccgagatgtttgagacacaagacacgttcttccagcacctacagacattgactgtacgcaacaatttcatggg
cgaaagtggctgtcgatcgctgctggaagctcttgagccgttcagcgagctgcaggtgctcgacctcagccgcaacatcctcacggacacggatgctttc
ggactggcggatttgctcgacgatcctgtgacagacacgttggaggatgatcccaaggcctcgtctgagcacttcaacgtgcttggactcgcaggtctgc
gcacgctgaagctgcaggagaacttcatcacttgtgacgggttccacgccatcacaattgccctatgctctcgagaagactttgtgactacggtcggtga
taccgcagcgtacagtgatgaagaggaggaggaagaagaagtagaactgatggaggagcaataagtagaacggtatttatgagctaaagcaacttgaatc
aatataaatagagaacttgtatcgc