Transcript Name :
Phyca_LT153470726
Orientation:
(+)
Number of Exons:
2
Description :
carbohydratebinding protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-163
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K14308
Cluster Id
2887
Sequence
        555 bases(100 bases per row)
atgtacaacactgtcgacccgacgcagcgccatctgtacactcgaccaccacacattagcgagcgcctgtggaaccaagccgagttggacaacccggacc
cgcttaactgcgctcccgttcctatcctgggctttgataacttgctgaagcgtatcaaggcgcagcaggagcatgccgagaagtacagtaagttcacgga
cgacctacgcgcacagctcaaggaaatggacaagcacacgcgaaccacagaagagaagctcgaaaagtgccgccacgaacacgtgcagctcttccacgcc
ctcgtgaaggttatgagggatatcgagctgctgcagaactacggcaagccgctccagcgcgaagagatgcaacttgcgtacgttgtggctcgatcaagta
tctctgcacttgatcctaactttgtgtgttttgttattcgtaggatgtcgctgaaaaagctccagacgttgctggactcgcctggccagtacaaagcacg
tctgaatgacgcggtgtccttgcagcgcgtccagaaggaagcacaacctgctccg