Transcript Name :
Phyca_LT1534557914
Orientation:
(+)
Number of Exons:
2
Description :
eukaryotic initiation factor 2 beta subunit
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Translation initiation factor IF2/IF51.2SM00653
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-230
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
translation initiation factor activityGO:0003743IEA
translational initiationGO:0006413IEA
KO ID
K03238
Cluster Id
1523
Sequence
        1585 bases(100 bases per row)
gcaaccagccaagcagggggagcactactaagatcaacgatggctgacgtcgagaagcaagaccttccgcccacgggcgatgccgtggccccgcccgccg
ttcctgaggatgtggccgcaatgttcgacttgaagaagaagaagaagaaatccaagaaggtcaagaaggaggtaacaaaaaaactcttttagaaaatgtt
ttgaacattattcctaattcttttatttaatattaacagaagaaggacaagtcggaagatgccgtggctgatgctgcaccagatgccaactcggtgctgg
tgcaggaccccgctacttactcgtacaaggacgagcttttggcccgtatcatggctaagctgcacgagaacaacccggagcttacggaccgcaagcgtca
caccatgaagccgccgcagctcatgcgtgtgggtaccaagaagacgctgtgggtgaacttccaggagatctgccagatgatgcaccgttcgcccgaacac
gtgctgcagttcacgctagccgaactgggtacggaaggatccatcgatggcaaccagcgcctcgtcatccgtggtcgctatgtgcccaagtacattgagt
cgctgctacgcaagtacatcaccgagtacgtctcgtgccagatgtgccgctcgccgaacaccacgctcacgcgtgactcggtcagccgcttgtacttcgt
gcactgccaggactgcggctcgtcgcggtctgtggctgctatccgctcgggtttccacgctgctacccgtgctgacagaagggctgcccgcaagtaagac
tgccgtcgcaattacagcgctcgatgggatcctgtcgagctttcggacggacagttttacacgtggacgaagggaaaaggttagagcaagaaattggaca
ctccggagctatttggtgctcgcctagagctgctctcgtgggctttgcaagtgtgagatacagacgaacgtacgtacgttgaagcttttgaagcgagaga
tgaacacggagaagaagaggaatctattatagctgttcggtgtcgataggctagctaagtctttgtctcattaaccttctttggccagaacttagcggcg
gcgcttgctcttcttagccttgcggtctgcaccagcatctgcagccgtacgcttcccaagacgcgagataatgatatggcgctcgaggccagagcccatg
ctctcgtgggcaagtccaagacgctcagcgcagtcatgtgctagcagtcgctcgaagccgttcaggttcgcatcaagatgcatttcgtccgcttcacttg
actcgctgaaagcctcgatcttcttcactaaagtgtgggaactgccctccgagatgcctccagccttttggttacgaggctttggagcagctcgaggtgt
tggcttgacaacaggttttactggaggagcttcatcctccgaagagtctgagcttgagtccgaagctaccttcttcttcggaacaggagcttcatcttca
gattcttccgaagaagactcggacgatgactctgagactggcttaggtgctggcttgcgaacaatcttctttgtctgcttcacaa