Transcript Name :
Phyca_LT15344125
Orientation:
(-)
Number of Exons:
4
Description :
zinc finger protein GIS2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type8.862PS50158
Zinc finger, CCHC-type9.521PS50158
HmmSmart predictionP-Valprediction_id
Zinc finger, CCHC-type0.11SM00343
Zinc finger, CCHC-type0.023SM00343
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-303
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        1359 bases(100 bases per row)
atgtccaacatcatgaaggtgctgccgatgttctattcggatacggcgactgtggagaaagcgcgcgacttctgggagctgttcgaggctcatacgggac
aattacctgacagggaacggttgttagtgttccgtcagaagctgaagggacgcgaagcggaacggtggtggggaaattctcggatcaagacgttcgctac
tctgaaagtacggttccacaatcagttcttgagtcggacgacggacgagctctgggaacggttgcaccatacgaagcgccaacgcggtgaatcggtggaa
gagtggggggaccgtgtcacggacctctgcgactctctcgagtacccaaactgtaacgggctatgtctttaccgttactagcttacacgtagcaatgagg
aagctcgtaaatagaccaagatagacttaactcttagtaaaatagactctgatttattttgggttcagggcggaaaccctggactcatgtgagccactca
aatgcaggtcgactcctgattggccgtaatgctgcaccttttgtccaatcagagagcgacaacacagcacgcgctagccgcgtgcttttgtacctactat
gtatgtagacctatatatatatgtctacctatatgcatatgtaactggggaggcccattacacaaaccagaagctgcgttttaatctgttctgtcgaggg
ctgaggaacaagcgtatgcaagctgctctcgactcgagtcccgcccgtgacattcctgaggcgtgtgaatggctgatgttcaaggagatgcaccgtcccg
ccgaagaggacgacgatttttcggacggactaaccaagctacggcatctgtggacgccctgacgcaacagttgcagacattcatgcagcagcagcaacag
tggcagcagaagttgatggaaggccgttgggcgcagcctaggtctcctaaatcgcgcttgccgaccgtgtcagctgtgacgacatcacctgggaacggtc
aaggttactccgggaacggtcaagggttcaacgggaacggacgtacgcgtgggatcaagatggcggctgatacgcggacgcaggagggtgaaccggtgtg
cggtaggtgtgattaccgtggacactctcgcgaagcgtgcatgcgacggacgatgacctgtcgtagatgcggacagctcggtcatattgtggtcgagtgc
gagcagccgtggaacggaggtcaggcgaccgctccgtccctgaagtgctacttctgtggtgaggcgggccatgctgtgagccggtgcccgaccattactg
ccctgaagggattggccactagtgcagcgtccggtactcccactacgcctcgaaactga